TBK1 Rabbit Polyclonal Antibody

TBK1 Rabbit Polyclonal Antibody

TBK1 Rabbit pAb

A14641-100ul 100 ul
EUR 308

TBK1 Rabbit pAb

A14641-200ul 200 ul
EUR 459

TBK1 Rabbit pAb

A14641-20ul 20 ul
EUR 183

TBK1 Rabbit pAb

A14641-50ul 50 ul
EUR 223

TBK1 Rabbit pAb

A2573-100ul 100 ul
EUR 308

TBK1 Rabbit pAb

A2573-200ul 200 ul
EUR 459

TBK1 Rabbit pAb

A2573-20ul 20 ul
EUR 183

TBK1 Rabbit pAb

A2573-50ul 50 ul
EUR 223

Human TANK Binding Kinase 1 (TBK1) ELISA Kit

DLR-TBK1-Hu-48T 48T
EUR 517
  • Should the Human TANK Binding Kinase 1 (TBK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human TANK Binding Kinase 1 (TBK1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human TANK Binding Kinase 1 (TBK1) ELISA Kit

DLR-TBK1-Hu-96T 96T
EUR 673
  • Should the Human TANK Binding Kinase 1 (TBK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human TANK Binding Kinase 1 (TBK1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human TANK Binding Kinase 1 (TBK1) ELISA Kit

RD-TBK1-Hu-48Tests 48 Tests
EUR 521

Human TANK Binding Kinase 1 (TBK1) ELISA Kit

RD-TBK1-Hu-96Tests 96 Tests
EUR 723

Human TANK Binding Kinase 1 (TBK1) ELISA Kit

RDR-TBK1-Hu-48Tests 48 Tests
EUR 544

Human TANK Binding Kinase 1 (TBK1) ELISA Kit

RDR-TBK1-Hu-96Tests 96 Tests
EUR 756

Polyclonal TBK1 Antibody (S172)

AMM08125G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBK1 (S172). This antibody is tested and proven to work in the following applications:

TBK1 antibody

70R-5732 50 ug
EUR 467
Description: Rabbit polyclonal TBK1 antibody raised against the N terminal of TBK1

TBK1 antibody

70R-5838 50 ug
EUR 467
Description: Rabbit polyclonal TBK1 antibody raised against the middle region of TBK1

TBK1 Antibody

ABD7026 100 ug
EUR 438

TBK1 Antibody

32724-100ul 100ul
EUR 252

TBK1 Antibody

DF7026 200ul
EUR 304
Description: TBK1 Antibody detects endogenous levels of total TBK1.

TBK1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TBK1. Recognizes TBK1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

TBK1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBK1. Recognizes TBK1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

TBK1 Polyclonal Antibody, HRP Conjugated

A57824 100 µg
EUR 570.55
Description: The best epigenetics products

Polyclonal Mouse Tbk1 Antibody (N-term)

APR17452G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Tbk1 (N-term). This antibody is tested and proven to work in the following applications:

Phospho-TBK1-S172 Rabbit pAb

AP0847-100ul 100 ul
EUR 384

Phospho-TBK1-S172 Rabbit pAb

AP0847-200ul 200 ul
EUR 554

Phospho-TBK1-S172 Rabbit pAb

AP0847-20ul 20 ul
EUR 183

Phospho-TBK1-S172 Rabbit pAb

AP0847-50ul 50 ul
EUR 265

Phospho-TBK1-T156 Rabbit pAb

AP1087-100ul 100 ul
EUR 384

Phospho-TBK1-T156 Rabbit pAb

AP1087-200ul 200 ul
EUR 554

Phospho-TBK1-T156 Rabbit pAb

AP1087-20ul 20 ul
EUR 183

Phospho-TBK1-T156 Rabbit pAb

AP1087-50ul 50 ul
EUR 265

Serine/threonine-Protein Kinase TBK1 (TBK1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase TBK1 (TBK1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase TBK1 (TBK1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase TBK1 (Tbk1) Antibody

abx029446-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase TBK1 (Tbk1) Antibody

abx029446-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase TBK1 (TBK1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase TBK1 (TBK1) Antibody

abx433346-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

TBK1 Conjugated Antibody

C32724 100ul
EUR 397

TBK1 (pS172) Antibody

abx218904-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

NAK / TBK1 Antibody

48319-100ul 100ul
EUR 333

NAK / TBK1 Antibody

48319-50ul 50ul
EUR 239

Anti-TBK1 Antibody

STJ503212 100 µg
EUR 476

Anti-TBK1 antibody

STJ95926 200 µl
EUR 197
Description: Rabbit polyclonal to TBK1.

Anti-TBK1 antibody

STJ25781 100 µl
EUR 277
Description: The NF-kappa-B (NFKB) complex of proteins is inhibited by I-kappa-B (IKB) proteins, which inactivate NFKB by trapping it in the cytoplasm. Phosphorylation of serine residues on the IKB proteins by IKB kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation and nuclear translocation of the NFKB complex. The protein encoded by this gene is similar to IKB kinases and can mediate NFKB activation in response to certain growth factors.

Anti-TBK1 antibody

STJ116848 100 µl
EUR 277
Description: The NF-kappa-B (NFKB) complex of proteins is inhibited by I-kappa-B (IKB) proteins, which inactivate NFKB by trapping it in the cytoplasm. Phosphorylation of serine residues on the IKB proteins by IKB kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation and nuclear translocation of the NFKB complex. The protein encoded by this gene is similar to IKB kinases and can mediate NFKB activation in response to certain growth factors.

Serine/threonine-Protein Kinase TBK1 (TBK1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase TBK1 (TBK1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase TBK1 (TBK1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NAK/TBK1 (N-term) Rabbit mAb

A3458-100ul 100 ul
EUR 410

NAK/TBK1 (N-term) Rabbit mAb

A3458-200ul 200 ul
EUR 571

NAK/TBK1 (N-term) Rabbit mAb

A3458-20ul 20 ul
EUR 221

NAK/TBK1 (N-term) Rabbit mAb

A3458-50ul 50 ul
EUR 287


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT12959 2 ug
EUR 391

Anti-NAK/TBK1 (N-term) Rabbit Monoclonal Antibody

M00261 100ug/vial
EUR 397
Description: Rabbit Monoclonal NAK/TBK1 (N-term) Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

Phospho-TBK1 (Ser172) Antibody

AF8190 200ul
EUR 376
Description: TBK1 (Phospho-Ser172) Antibody detects endogenous levels of TBK1 only when phosphorylated at Ser172.

NAK / TBK1 Conjugated Antibody

C48319 100ul
EUR 397

TBK1 (Phospho- Ser172) Antibody

ABF8190 100 ug
EUR 438

TBK1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBK1. Recognizes TBK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TBK1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBK1. Recognizes TBK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TBK1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBK1. Recognizes TBK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-NAK/TBK1 Antibody

PA2117 100ug/vial
EUR 334

Anti-TBK1 Antibody (Biotin)

STJ503213 100 µg
EUR 586

Anti-TBK1 Antibody (FITC)

STJ503214 100 µg
EUR 586

TBK1 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

TBK1 Blocking Peptide

33R-2352 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TBK1 antibody, catalog no. 70R-5732

TBK1 Blocking Peptide

33R-7524 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TBK1 antibody, catalog no. 70R-5838

TBK1 Blocking Peptide

DF7026-BP 1mg
EUR 195

TBK1 cloning plasmid

CSB-CL890690HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2190
  • Sequence: atgcagagcacttctaatcatctgtggcttttatctgatattttaggccaaggagctactgcaaatgtctttcgtggaagacataagaaaactggtgatttatttgctatcaaagtatttaataacataagcttccttcgtccagtggatgttcaaatgagagaatttgaagtgt
  • Show more
Description: A cloning plasmid for the TBK1 gene.


PVT19162 2 ug
EUR 300

Anti-TBK1 (aa514-527) antibody

STJ72634 100 µg
EUR 359

Antibody for Human TBK1 (pSer172)

SPC-1088D 0.1ml
EUR 354
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is unconjugated.

Antibody for Human TBK1 (pSer172)

SPC-1088D-A390 0.1ml
EUR 401
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to ATTO 390.

Antibody for Human TBK1 (pSer172)

SPC-1088D-A488 0.1ml
EUR 400
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to ATTO 488.

Antibody for Human TBK1 (pSer172)

SPC-1088D-A565 0.1ml
EUR 400
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to ATTO 565.

Antibody for Human TBK1 (pSer172)

SPC-1088D-A594 0.1ml
EUR 400
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to ATTO 594.

Antibody for Human TBK1 (pSer172)

SPC-1088D-A633 0.1ml
EUR 400
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to ATTO 633.

TBK1 Rabbit Polyclonal Antibody