STK32C Rabbit Polyclonal Antibody

STK32C Rabbit Polyclonal Antibody

STK32C Polyclonal Antibody

ABP54578-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human STK32C at AA rangle: 310-390
  • Applications tips:
Description: A polyclonal antibody for detection of STK32C from Human, Mouse. This STK32C antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human STK32C at AA rangle: 310-390

STK32C Polyclonal Antibody

ABP54578-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human STK32C at AA rangle: 310-390
  • Applications tips:
Description: A polyclonal antibody for detection of STK32C from Human, Mouse. This STK32C antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human STK32C at AA rangle: 310-390

STK32C antibody

70R-20598 50 ul
EUR 435
Description: Rabbit polyclonal STK32C antibody

STK32C Antibody

ABD4464 100 ug
EUR 438

STK32C Antibody

37971-100ul 100ul
EUR 252

STK32C Antibody

DF4464 200ul
EUR 304
Description: STK32C Antibody detects endogenous levels of total STK32C.

STK32C Antibody

1-CSB-PA978451
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STK32C. Recognizes STK32C from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:20-1:100

STK32C Antibody

1-CSB-PA008897
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against STK32C. Recognizes STK32C from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

STK32C Antibody

1-CSB-PA022847GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STK32C. Recognizes STK32C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

STK32C Conjugated Antibody

C37971 100ul
EUR 397

anti- STK32C antibody

FNab08333 100µg
EUR 548.75
  • Immunogen: serine/threonine kinase 32C
  • Uniprot ID: Q86UX6
  • Gene ID: 282974
  • Research Area: Metabolism
Description: Antibody raised against STK32C

Anti-STK32C antibody

PAab08333 100 ug
EUR 386

Anti-STK32C antibody

STJ95825 200 µl
EUR 197
Description: Rabbit polyclonal to STK32C.

STK32C siRNA

20-abx935475
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STK32C siRNA

20-abx935476
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STK32C Blocking Peptide

DF4464-BP 1mg
EUR 195

STK32C cloning plasmid

CSB-CL773035HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1110
  • Sequence: atgtacgccatgaagtacatgaacaagcagcagtgcatcgagcgcgacgaggtccgcaacgtcttccgggagctggagatcctgcaggagatcgagcacgtcttcctggtgaacctctggtactccttccaggacgaggaggacatgttcatggtcgtggacctgctactgggcg
  • Show more
Description: A cloning plasmid for the STK32C gene.

Anti-STK32C (3B4)

YF-MA11774 100 ug
EUR 363
Description: Mouse monoclonal to STK32C

Anti-STK32C (4D12)

YF-MA20077 100 ug
EUR 363
Description: Mouse monoclonal to STK32C

Anti-STK32C (3E8)

YF-MA20078 100 ug
EUR 363
Description: Mouse monoclonal to STK32C

Anti-STK32C (4G2)

YF-MA20079 100 ug
EUR 363
Description: Mouse monoclonal to STK32C

Mouse STK32C shRNA Plasmid

20-abx975008
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STK32C ELISA KIT|Human

EF003312 96 Tests
EUR 689

Human STK32C shRNA Plasmid

20-abx966857
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STK32C Recombinant Protein (Human)

RP030427 100 ug Ask for price

STK32C Recombinant Protein (Rat)

RP231473 100 ug Ask for price

STK32C Recombinant Protein (Mouse)

RP176078 100 ug Ask for price

STK32C Recombinant Protein (Mouse)

RP176081 100 ug Ask for price

Serine/Threonine Kinase 32C (STK32C) Antibody

20-abx115448
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 32C (STK32C) Antibody

20-abx119452
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 32C (STK32C) Antibody

20-abx326029
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 32C (STK32C) Antibody

abx238333-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Serine/Threonine Kinase 32C (STK32C) Antibody

20-abx211545
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Monoclonal STK32C Antibody (monoclonal) (M02), Clone: 3B4

AMM08024G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human STK32C (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3B4. This antibody is applicable in WB and IHC

Monoclonal STK32C Antibody (monoclonal) (M05), Clone: 3E9

AMM08025G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human STK32C (monoclonal) (M05). The antibodies are raised in mouse and are from clone 3E9. This antibody is applicable in WB

h STK32C inducible lentiviral particles

LVP063 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, STK32C, is fully sequence verified and matched to NCBI accession ID: NM_173575

Stk32c ORF Vector (Mouse) (pORF)

ORF058694 1.0 ug DNA
EUR 506

Stk32c ORF Vector (Mouse) (pORF)

ORF058695 1.0 ug DNA
EUR 506

STK32C ORF Vector (Human) (pORF)

ORF010143 1.0 ug DNA
EUR 95

Stk32c ORF Vector (Rat) (pORF)

ORF077159 1.0 ug DNA
EUR 506

STK32C sgRNA CRISPR Lentivector set (Human)

K2304101 3 x 1.0 ug
EUR 339

Stk32c sgRNA CRISPR Lentivector set (Mouse)

K3084401 3 x 1.0 ug
EUR 339

Stk32c sgRNA CRISPR Lentivector set (Rat)

K6497301 3 x 1.0 ug
EUR 339

STK32C sgRNA CRISPR Lentivector (Human) (Target 1)

K2304102 1.0 ug DNA
EUR 154

STK32C sgRNA CRISPR Lentivector (Human) (Target 2)

K2304103 1.0 ug DNA
EUR 154

STK32C sgRNA CRISPR Lentivector (Human) (Target 3)

K2304104 1.0 ug DNA
EUR 154

Stk32c sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3084402 1.0 ug DNA
EUR 154

Stk32c sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3084403 1.0 ug DNA
EUR 154

Stk32c sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3084404 1.0 ug DNA
EUR 154

Stk32c sgRNA CRISPR Lentivector (Rat) (Target 1)

K6497302 1.0 ug DNA
EUR 154

Stk32c sgRNA CRISPR Lentivector (Rat) (Target 2)

K6497303 1.0 ug DNA
EUR 154

Stk32c sgRNA CRISPR Lentivector (Rat) (Target 3)

K6497304 1.0 ug DNA
EUR 154

STK32C Protein Vector (Human) (pPB-C-His)

PV040569 500 ng
EUR 329

STK32C Protein Vector (Human) (pPB-N-His)

PV040570 500 ng
EUR 329

STK32C Protein Vector (Human) (pPM-C-HA)

PV040571 500 ng
EUR 329

STK32C Protein Vector (Human) (pPM-C-His)

PV040572 500 ng
EUR 329

STK32C Protein Vector (Rat) (pPB-C-His)

PV308634 500 ng
EUR 603

STK32C Protein Vector (Rat) (pPB-N-His)

PV308635 500 ng
EUR 603

STK32C Protein Vector (Rat) (pPM-C-HA)

PV308636 500 ng
EUR 603

STK32C Protein Vector (Rat) (pPM-C-His)

PV308637 500 ng
EUR 603

STK32C Protein Vector (Mouse) (pPB-C-His)

PV234774 500 ng
EUR 603

STK32C Protein Vector (Mouse) (pPB-N-His)

PV234775 500 ng
EUR 603

STK32C Protein Vector (Mouse) (pPM-C-HA)

PV234776 500 ng
EUR 603

STK32C Protein Vector (Mouse) (pPM-C-His)

PV234777 500 ng
EUR 603

STK32C Protein Vector (Mouse) (pPB-C-His)

PV234778 500 ng
EUR 603

STK32C Protein Vector (Mouse) (pPB-N-His)

PV234779 500 ng
EUR 603

STK32C Protein Vector (Mouse) (pPM-C-HA)

PV234780 500 ng
EUR 603

STK32C Protein Vector (Mouse) (pPM-C-His)

PV234781 500 ng
EUR 603

Stk32c 3'UTR GFP Stable Cell Line

TU169852 1.0 ml Ask for price

Stk32c 3'UTR Luciferase Stable Cell Line

TU119852 1.0 ml Ask for price

STK32C 3'UTR GFP Stable Cell Line

TU074824 1.0 ml
EUR 1394

STK32C 3'UTR Luciferase Stable Cell Line

TU024824 1.0 ml
EUR 1394

Stk32c 3'UTR Luciferase Stable Cell Line

TU221318 1.0 ml Ask for price

Stk32c 3'UTR GFP Stable Cell Line

TU271318 1.0 ml Ask for price

Human Serine/Threonine Kinase 32C (STK32C) ELISA Kit

abx383526-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

STK32C Rabbit Polyclonal Antibody