Ksr2 Rabbit Polyclonal Antibody

Ksr2 Rabbit Polyclonal Antibody

Ksr2 Polyclonal Antibody

ABP54585-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Ksr2 at AA rangle: 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of Ksr2 from Human, Mouse. This Ksr2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Ksr2 at AA rangle: 640-720

Ksr2 Polyclonal Antibody

ABP54585-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Ksr2 at AA rangle: 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of Ksr2 from Human, Mouse. This Ksr2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Ksr2 at AA rangle: 640-720

Ksr2 Polyclonal Antibody

ABP54585-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Ksr2 at AA rangle: 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of Ksr2 from Human, Mouse. This Ksr2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Ksr2 at AA rangle: 640-720

KSR2 Rabbit pAb

A17866-100ul 100 ul
EUR 308

KSR2 Rabbit pAb

A17866-200ul 200 ul
EUR 459

KSR2 Rabbit pAb

A17866-20ul 20 ul
EUR 183

KSR2 Rabbit pAb

A17866-50ul 50 ul
EUR 223

Polyclonal KSR2 Antibody (Ile694)

APR17143G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KSR2 (Ile694). This antibody is tested and proven to work in the following applications:

KSR2 Antibody

AF4642 200ul
EUR 376
Description: KSR2 Antibody detects endogenous levels of KSR2.

KSR2 Antibody

AF0688 200ul
EUR 304
Description: KSR2 Antibody detects endogenous levels of KSR2.

KSR2 Antibody

ABF0688 100 ug
EUR 438

KSR2 antibody

70R-31966 100 ug
EUR 327
Description: Rabbit polyclonal KSR2 antibody

KSR2 Antibody

ABD3328 100 ug
EUR 438

KSR2 Antibody

33940-100ul 100ul
EUR 252

KSR2 Antibody

33940-50ul 50ul
EUR 187

KSR2 Antibody

DF3328 200ul
EUR 304
Description: KSR2 Antibody detects endogenous levels of total KSR2.

KSR2 Antibody

1-CSB-PA012696LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KSR2. Recognizes KSR2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

KSR2 Antibody

CSB-PA581207-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against KSR2. Recognizes KSR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

KSR2 Antibody

CSB-PA581207-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against KSR2. Recognizes KSR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

KSR2 Antibody

1-CSB-PA008904
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against KSR2. Recognizes KSR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

Polyclonal KSR2 Antibody (C-term)

APR17142G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KSR2 (C-term). This antibody is tested and proven to work in the following applications:

KSR2 Conjugated Antibody

C33940 100ul
EUR 397

Mouse Ksr2 Antibody

abx028193-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Ksr2 Antibody

abx028193-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Anti-KSR2 Antibody

A06876 100ul
EUR 397
Description: Rabbit Polyclonal KSR2 Antibody. Validated in IF, WB and tested in Human, Mouse.

Anti-Ksr2 antibody

STJ93862 200 µl
EUR 197
Description: Rabbit polyclonal to Ksr2.

Anti-KSR2 antibody

STJ119878 100 µl
EUR 277

KSR2 siRNA

20-abx922169
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-KSR2

YF-PA22884 50 ug
EUR 363
Description: Mouse polyclonal to KSR2

anti-KSR2

YF-PA27017 50 ul
EUR 334
Description: Mouse polyclonal to KSR2

Phospho-KSR2(Thr497) Antibody

AF4342 200ul
EUR 376
Description: Phospho-KSR2(Thr497) Antibody detects endogenous levels of KSR2 only when phosphorylated at Thr497.

KSR2 Antibody, HRP conjugated

1-CSB-PA012696LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KSR2. Recognizes KSR2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KSR2 Antibody, FITC conjugated

1-CSB-PA012696LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KSR2. Recognizes KSR2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KSR2 Antibody, Biotin conjugated

1-CSB-PA012696LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KSR2. Recognizes KSR2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

KSR2 Blocking Peptide

AF4642-BP 1mg
EUR 195

KSR2 Blocking Peptide

AF0688-BP 1mg
EUR 195

KSR2 cloning plasmid

CSB-CL012696HU-10ug 10ug
EUR 807
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2490
  • Sequence: ATGACGGATGAACAGGTGTGCGAGACTGTGGAGAAATACGGAGCCAACCGGGAGGAGTGTGCCCGCCTCAACGCCTCCCTCTCCTGCCTCAGGAATGTCCACATGTCAGGAGGCAACCTTTCCAAACAAGACTGGACCATCCAGTGGCCCACCACAGAGACGGGGAAGGAGAACA
  • Show more
Description: A cloning plasmid for the KSR2 gene.

KSR2 Blocking Peptide

DF3328-BP 1mg
EUR 195

Anti-KSR2 (6C9)

YF-MA11775 100 ug
EUR 363
Description: Mouse monoclonal to KSR2

Anti-KSR2 (1G4)

YF-MA11776 100 ug
EUR 363
Description: Mouse monoclonal to KSR2

Anti-KSR2 (6F12)

YF-MA20084 50 ug
EUR 363
Description: Mouse monoclonal to KSR2

Anti-KSR2 (6F12)

YF-MA20085 200 ul
EUR 363
Description: Mouse monoclonal to KSR2

Anti-KSR2 (2G12)

YF-MA20086 100 ug
EUR 363
Description: Mouse monoclonal to KSR2

Anti-KSR2 (4H2)

YF-MA20087 100 ug
EUR 363
Description: Mouse monoclonal to KSR2

Anti-KSR2 (5C4)

YF-MA20088 100 ug
EUR 363
Description: Mouse monoclonal to KSR2

Anti-KSR2 (5E9)

YF-MA20089 100 ug
EUR 363
Description: Mouse monoclonal to KSR2

Anti-KSR2 (3F11)

YF-MA20090 100 ug
EUR 363
Description: Mouse monoclonal to KSR2

Antibody for Human Ksr2 (pSer490)

SPC-1004D 0.1ml
EUR 354
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is unconjugated.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-A390 0.1ml
EUR 401
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to ATTO 390.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-A488 0.1ml
EUR 400
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to ATTO 488.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-A565 0.1ml
EUR 400
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to ATTO 565.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-A594 0.1ml
EUR 400
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to ATTO 594.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-A633 0.1ml
EUR 400
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to ATTO 633.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-A655 0.1ml
EUR 400
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to ATTO 655.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-A680 0.1ml
EUR 400
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to ATTO 680.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-A700 0.1ml
EUR 400
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to ATTO 700.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-ALP 0.1ml
EUR 394
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to Alkaline Phosphatase.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-APC 0.1ml
EUR 399
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to APC .

Antibody for Human Ksr2 (pSer490)

SPC-1004D-APCCY7 0.1ml
EUR 471
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to APC/Cy7.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-BI 0.1ml
EUR 396
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to Biotin.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-DY350 0.1ml
EUR 475
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to Dylight 350.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-DY405 0.1ml
EUR 452
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to Dylight 405.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-DY488 0.1ml
EUR 432
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to Dylight 488.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-DY594 0.1ml
EUR 436
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to Dylight 594.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-DY633 0.1ml
EUR 426
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to Dylight 633.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-FITC 0.1ml
EUR 392
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to FITC.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-HRP 0.1ml
EUR 388
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to HRP.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-P594 0.1ml
EUR 407
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to PE/ATTO 594.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-PCP 0.1ml
EUR 399
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to PerCP.

Antibody for Human Ksr2 (pSer490)

SPC-1004D-RPE 0.1ml
EUR 397
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to RPE .

Antibody for Human Ksr2 (pSer490)

SPC-1004D-STR 0.1ml
EUR 398
Description: A polyclonal antibody for Ksr2 (pSer490) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser490 of human Ksr2 (AA487-493). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This Ksr2 (pSer490) antibody is conjugated to Streptavidin.

Human KSR2 ELISA Kit

ELA-E1806h 96 Tests
EUR 824

KSR2 ELISA KIT|Human

EF006050 96 Tests
EUR 689

Human KSR2 shRNA Plasmid

20-abx966905
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Monoclonal KSR2 Antibody (monoclonal) (M02), Clone: 6C9

APR17144G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human KSR2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 6C9. This antibody is applicable in WB and IF, E

Monoclonal KSR2 Antibody (monoclonal) (M08), Clone: 1G4

APR17145G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human KSR2 (monoclonal) (M08). The antibodies are raised in Mouse and are from clone 1G4. This antibody is applicable in WB, E

Kinase Suppressor of Ras 2 (KSR2) Antibody

abx026265-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Kinase Suppressor of Ras 2 (KSR2) Antibody

abx026265-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Kinase Suppressor of Ras 2 (KSR2) Antibody

20-abx013666
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Kinase suppressor of Ras 2 (KSR2) Antibody

20-abx326191
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kinase suppressor of Ras 2 (KSR2) Antibody

abx331475-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Kinase suppressor of Ras 2 (KSR2) Antibody

20-abx333872
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospho-KSR2(Thr497) Blocking Peptide

AF4342-BP 1mg
EUR 195

KSR2 Colorimetric Cell-Based ELISA

EKC1857 100ul
EUR 572

Ksr2 ORF Vector (Mouse) (pORF)

ORF048906 1.0 ug DNA
EUR 506

KSR2 ORF Vector (Human) (pORF)

ORF022575 1.0 ug DNA
EUR 405

KSR2 ELISA Kit (Human) (OKEH04713)

OKEH04713 96 Wells
EUR 662
Description: Description of target: Location-regulated scaffold connecting MEK to RAF. Has very low protein kinase activity and can phosphorylate MAP2K1 at several Ser and Thr residues with very low efficiency (in vitro). Interaction with BRAF enhances KSR2-mediated phosphorylation of MAP2K1 (in vitro). Blocks MAP3K8 kinase activity and MAP3K8-mediated signaling. Acts as a negative regulator of MAP3K3-mediated activation of ERK, JNK and NF-kappa-B pathways, inhibiting MAP3K3-mediated interleukin-8 production.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34 pg/mL

Ksr2 ELISA Kit (Mouse) (OKEH04714)

OKEH04714 96 Wells
EUR 662
Description: Description of target: Location-regulated scaffold connecting MEK to RAF. Has very low protein kinase activity and can phosphorylate MAP2K1 at several Ser and Thr residues with very low efficiency (in vitro). Interaction with BRAF enhances KSR2-mediated phosphorylation of MAP2K1 (in vitro). Blocks MAP3K8 kinase activity and MAP3K8-mediated signaling. Acts as a negative regulator of MAP3K3-mediated activation of ERK, JNK and NF-kappa-B pathways, inhibiting MAP3K3-mediated interleukin-8 production..;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.087 ng/mL

Kinase suppressor of Ras 2 (KSR2) Antibody (HRP)

20-abx336243
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kinase suppressor of Ras 2 (KSR2) Antibody (FITC)

20-abx336244
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kinase suppressor of Ras 2 (KSR2) Antibody (Biotin)

20-abx336245
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ksr2 sgRNA CRISPR Lentivector set (Mouse)

K4428401 3 x 1.0 ug
EUR 339

KSR2 sgRNA CRISPR Lentivector set (Human)

K1190801 3 x 1.0 ug
EUR 339

Ksr2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4428402 1.0 ug DNA
EUR 154

Ksr2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4428403 1.0 ug DNA
EUR 154

Ksr2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4428404 1.0 ug DNA
EUR 154

KSR2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1190802 1.0 ug DNA
EUR 154

KSR2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1190803 1.0 ug DNA
EUR 154

KSR2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1190804 1.0 ug DNA
EUR 154

KSR2 Protein Vector (Human) (pPB-C-His)

PV090298 500 ng
EUR 811

KSR2 Protein Vector (Human) (pPB-N-His)

PV090299 500 ng
EUR 811

KSR2 Protein Vector (Human) (pPM-C-HA)

PV090300 500 ng
EUR 811

KSR2 Protein Vector (Human) (pPM-C-His)

PV090301 500 ng
EUR 811

KSR2 Protein Vector (Mouse) (pPB-C-His)

PV195622 500 ng
EUR 1065

KSR2 Protein Vector (Mouse) (pPB-N-His)

PV195623 500 ng
EUR 1065

KSR2 Protein Vector (Mouse) (pPM-C-HA)

PV195624 500 ng
EUR 1065

KSR2 Protein Vector (Mouse) (pPM-C-His)

PV195625 500 ng
EUR 1065

Ksr2 3'UTR GFP Stable Cell Line

TU160855 1.0 ml Ask for price

KSR2 3'UTR Luciferase Stable Cell Line

TU012212 1.0 ml
EUR 4617

Ksr2 3'UTR Luciferase Stable Cell Line

TU110855 1.0 ml Ask for price

KSR2 3'UTR GFP Stable Cell Line

TU062212 1.0 ml
EUR 4617

KSR2 Colorimetric Cell-Based ELISA Kit (OKAG01380)

OKAG01380 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:

Kinase Suppressor Of Ras 2 (KSR2) ELISA Kit

abx595890-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Ksr2 Rabbit Polyclonal Antibody