GPS2 Rabbit Polyclonal Antibody

GPS2 Rabbit Polyclonal Antibody

GPS2 Polyclonal Antibody

ABP54629-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human GPS2 at AA rangle: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of GPS2 from Human, Mouse, Rat. This GPS2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human GPS2 at AA rangle: 30-110

GPS2 Polyclonal Antibody

ES5628-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPS2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPS2 Polyclonal Antibody

ES5628-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPS2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPS2 antibody

70R-17584 50 ul
EUR 435
Description: Rabbit polyclonal GPS2 antibody

GPS2 antibody

10R-1050 100 ul
EUR 316
Description: Mouse monoclonal GPS2 antibody

GPS2 Antibody

DF4065 200ul
EUR 304
Description: GPS2 Antibody detects endogenous levels of total GPS2.

GPS2 antibody

70R-36656 100 ug
EUR 327
Description: Rabbit Polyclonal GPS2 antibody

GPS2 Antibody

1-CSB-PA008949
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPS2. Recognizes GPS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

GPS2 Antibody

1-CSB-PA009859GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GPS2. Recognizes GPS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GPS2 Antibody

1-CSB-PA009859LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPS2. Recognizes GPS2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

GPS2 Antibody

ABD4065 100 ug
EUR 438

Polyclonal GPS2 Antibody - C-terminal region

APR01855G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPS2 - C-terminal region. This antibody is tested and proven to work in the following applications:

Anti-GPS2 Antibody

A06569 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPS2 Antibody (GPS2) detection. Tested with WB in Human, Mouse, Rat.

anti- GPS2 antibody

FNab03617 100µg
EUR 505.25
  • Immunogen: G protein pathway suppressor 2
  • Uniprot ID: Q13227
  • Gene ID: 2874
  • Research Area: Cell Division and Proliferation, Signal Transduction, Epigenetics
Description: Antibody raised against GPS2

Anti-GPS2 antibody

PAab03617 100 ug
EUR 355

Anti-GPS2 Antibody

STJ501283 100 µg
EUR 476

Anti-GPS2 antibody

STJ23846 100 µl
EUR 277
Description: This gene encodes a protein involved in G protein-mitogen-activated protein kinase (MAPK) signaling cascades. When overexpressed in mammalian cells, this gene could potently suppress a RAS- and MAPK-mediated signal and interfere with JNK activity, suggesting that the function of this gene may be signal repression. The encoded protein is an integral subunit of the NCOR1-HDAC3 (nuclear receptor corepressor 1-histone deacetylase 3) complex, and it was shown that the complex inhibits JNK activation through this subunit and thus could potentially provide an alternative mechanism for hormone-mediated antagonism of AP1 (activator protein 1) function.

Anti-GPS2 antibody

STJ93406 200 µl
EUR 197
Description: Rabbit polyclonal to GPS2.

GPS2 siRNA

20-abx918595
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-GPS2

YF-PA12112 100 ug
EUR 403
Description: Rabbit polyclonal to GPS2

anti-GPS2

YF-PA23813 50 ul
EUR 334
Description: Mouse polyclonal to GPS2

GPS2 Antibody, HRP conjugated

1-CSB-PA009859LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPS2. Recognizes GPS2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GPS2 Antibody, FITC conjugated

1-CSB-PA009859LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPS2. Recognizes GPS2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GPS2 Antibody, Biotin conjugated

1-CSB-PA009859LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPS2. Recognizes GPS2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-GPS2 Antibody (Biotin)

STJ501284 100 µg
EUR 586

Anti-GPS2 Antibody (FITC)

STJ501285 100 µg
EUR 586

GPS2 Blocking Peptide

DF4065-BP 1mg
EUR 195

GPS2 cloning plasmid

CSB-CL009859HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 984
  • Sequence: atgcccgcactcctggagcgccccaagctttccaacgccatggccagggcgctgcaccggcacattatgatggagcgggagcgcaagcggcaggaggaagaagaggtggataagatgatggaacagaagatgaaggaagaacaggagagaaggaagaaaaaggagatggaagagag
  • Show more
Description: A cloning plasmid for the GPS2 gene.

pCMV-SPORT6-GPS2

PVT13452 2 ug
EUR 391

Anti-GPS2 (3C4)

YF-MA13313 100 ug
EUR 363
Description: Mouse monoclonal to GPS2

GPS2 ELISA KIT|Human

EF009976 96 Tests
EUR 689

Human GPS2 shRNA Plasmid

20-abx951931
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-GPS2 Plasmid

PVT17046 2 ug
EUR 325

GPS2 Recombinant Protein (Human)

RP013942 100 ug Ask for price

GPS2 Recombinant Protein (Rat)

RP203507 100 ug Ask for price

GPS2 Rabbit Polyclonal Antibody