GPR35 Rabbit Polyclonal Antibody

GPR35 Rabbit Polyclonal Antibody

GPR35 Polyclonal Antibody

ABP54615-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR35 at AA rangle: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of GPR35 from Human. This GPR35 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR35 at AA rangle: 30-110

GPR35 Polyclonal Antibody

ABP54615-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR35 at AA rangle: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of GPR35 from Human. This GPR35 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR35 at AA rangle: 30-110

GPR35 Rabbit pAb

A17953-100ul 100 ul
EUR 308

GPR35 Rabbit pAb

A17953-200ul 200 ul
EUR 459

GPR35 Rabbit pAb

A17953-20ul 20 ul
EUR 183

GPR35 Rabbit pAb

A17953-50ul 50 ul
EUR 223

Human G Protein Coupled Receptor 35 (GPR35) ELISA Kit

DLR-GPR35-Hu-48T 48T
EUR 517
  • Should the Human G Protein Coupled Receptor 35 (GPR35) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Receptor 35 (GPR35) in samples from tissue homogenates, cell lysates or other biological fluids.

Human G Protein Coupled Receptor 35 (GPR35) ELISA Kit

DLR-GPR35-Hu-96T 96T
EUR 673
  • Should the Human G Protein Coupled Receptor 35 (GPR35) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Receptor 35 (GPR35) in samples from tissue homogenates, cell lysates or other biological fluids.

Human G Protein Coupled Receptor 35 (GPR35) ELISA Kit

RD-GPR35-Hu-48Tests 48 Tests
EUR 521

Human G Protein Coupled Receptor 35 (GPR35) ELISA Kit

RD-GPR35-Hu-96Tests 96 Tests
EUR 723

Human G Protein Coupled Receptor 35 (GPR35) ELISA Kit

RDR-GPR35-Hu-48Tests 48 Tests
EUR 544

Human G Protein Coupled Receptor 35 (GPR35) ELISA Kit

RDR-GPR35-Hu-96Tests 96 Tests
EUR 756

GPR35 antibody

70R-30952 100 ug
EUR 327
Description: Rabbit polyclonal GPR35 antibody

GPR35 Antibody

ABD2741 100 ug
EUR 438

GPR35 Antibody

ABD4973 100 ug
EUR 438

GPR35 Antibody

44925-100ul 100ul
EUR 252

GPR35 Antibody

44925-50ul 50ul
EUR 187

GPR35 antibody

70R-17580 50 ul
EUR 435
Description: Rabbit polyclonal GPR35 antibody

GPR35 Antibody

DF4973 200ul
EUR 304
Description: GPR35 Antibody detects endogenous levels of total GPR35.

GPR35 Antibody

DF2741 200ul
EUR 304
Description: GPR35 antibody detects endogenous levels of total GPR35.

GPR35 Antibody

1-CSB-PA008935
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR35. Recognizes GPR35 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

GPR35 Antibody

1-CSB-PA009808GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GPR35. Recognizes GPR35 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal GPR35 Antibody (C-Terminus)

APR12217G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR35 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GPR35 Antibody (Extracellular Domain)

APR12218G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR35 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR35 Antibody - C-terminal region

APR12219G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR35 - C-terminal region. This antibody is tested and proven to work in the following applications:

GPR35 Conjugated Antibody

C44925 100ul
EUR 397

anti- GPR35 antibody

FNab03605 100µg
EUR 585
  • Immunogen: G protein-coupled receptor 35
  • Uniprot ID: Q9HC97
  • Gene ID: 2859
  • Research Area: Signal Transduction
Description: Antibody raised against GPR35

Anti-GPR35 Antibody

A06269 100 ug
EUR 397
Description: Rabbit IgG Polyclonal antibody for GPR35 detection. Tested with WB in Human and Mouse.

Anti-GPR35 antibody

PAab03605 100 ug
EUR 412

Anti-GPR35 antibody

STJ93380 200 µl
EUR 197
Description: Rabbit polyclonal to GPR35.

Anti-GPR35 antibody

STJ119935 100 µl
EUR 277

GPR35 siRNA

20-abx918518
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR35 siRNA

20-abx918519
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR35 cloning plasmid

CSB-CL881023HU-10ug 10ug
EUR 370
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 930
  • Sequence: atgaatggcacctacaacacctgtggctccagcgacctcacctggcccccagcgatcaagctgggcttctacgcctacttgggcgtcctgctggtgctaggcctgctgctcaacagcctggcgctctgggtgttctgctgccgcatgcagcagtggacggagacccgcatctacat
  • Show more
Description: A cloning plasmid for the GPR35 gene.

GPR35 Blocking Peptide

DF4973-BP 1mg
EUR 195

GPR35 Blocking Peptide

DF2741-BP 1mg
EUR 195

pCDNA3.1- GPR35- m

PVT10458 2 ug
EUR 301

pCDNA3.1- Zeo- GPR35

PVT11626 2 ug
EUR 304

Mouse GPR35 shRNA Plasmid

20-abx975255
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPR35 ELISA KIT|Human

EF009967 96 Tests
EUR 689

Human GPR35 shRNA Plasmid

20-abx951919
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPR35 Recombinant Protein (Human)

RP039577 100 ug Ask for price

pCDNA3.1- Zeo- GPR35- m

PVT11637 2 ug
EUR 304

pCDNA3.1- Zeo- GPR35- r

PVT11638 2 ug
EUR 304

GPR35 Recombinant Protein (Rat)

RP203417 100 ug Ask for price

GPR35 Recombinant Protein (Mouse)

RP139631 100 ug Ask for price

GPR35 Recombinant Protein (Mouse)

RP139634 100 ug Ask for price

G Protein Coupled Receptor 35 (GPR35) Antibody

20-abx112637
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

G Protein Coupled Receptor 35 (GPR35) Antibody

20-abx147399
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein Coupled Receptor 35 (GPR35) Antibody

20-abx015327
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

G Protein Coupled Receptor 35 (GPR35) Antibody

20-abx172494
  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

G Protein Coupled Receptor 35 (GPR35) Antibody

20-abx176529
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

G Protein Coupled Receptor 35 (GPR35) Antibody

20-abx324242
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein Coupled Receptor 35 (GPR35) Antibody

abx233605-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Gpr35 ORF Vector (Rat) (pORF)

ORF067807 1.0 ug DNA
EUR 506

Gpr35 ORF Vector (Mouse) (pORF)

ORF046545 1.0 ug DNA
EUR 506

Gpr35 ORF Vector (Mouse) (pORF)

ORF046546 1.0 ug DNA
EUR 506

GPR35 ORF Vector (Human) (pORF)

ORF013193 1.0 ug DNA
EUR 354

GPR35 ELISA Kit (Human) (OKCD08974)

OKCD08974 96 Wells
EUR 975
Description: Description of target: GPR35 acts as a receptor for kynurenic acid, an intermediate in the tryptophan metabolic pathway. The activity of this receptor is mediated by G-proteins that elicit calcium mobilization and inositol phosphate production through G(qi/o) proteins.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

GPR35 ELISA Kit (Human) (OKDD00292)

OKDD00292 96 Wells
EUR 975
Description: Description of target: Acts as a receptor for kynurenic acid, an intermediate in the tryptophan metabolic pathway. The activity of this receptor is mediated by G-proteins that elicit calcium mobilization and inositol phosphate production through G(qi/o) proteins.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.068 ng/mL

GPR35 sgRNA CRISPR Lentivector set (Human)

K0890901 3 x 1.0 ug
EUR 339

Gpr35 sgRNA CRISPR Lentivector set (Mouse)

K3451801 3 x 1.0 ug
EUR 339

Gpr35 sgRNA CRISPR Lentivector set (Rat)

K6273301 3 x 1.0 ug
EUR 339

G Protein Coupled Receptor 35 (GPR35) Monoclonal Antibody (Human)

4-MAG725Hu21
  • EUR 255.00
  • EUR 2642.00
  • EUR 655.00
  • EUR 322.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg240~Ala309
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human G Protein Coupled Receptor 35 (GPR35)

GPR35 sgRNA CRISPR Lentivector (Human) (Target 1)

K0890902 1.0 ug DNA
EUR 154

GPR35 sgRNA CRISPR Lentivector (Human) (Target 2)

K0890903 1.0 ug DNA
EUR 154

GPR35 sgRNA CRISPR Lentivector (Human) (Target 3)

K0890904 1.0 ug DNA
EUR 154

Gpr35 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3451802 1.0 ug DNA
EUR 154

Gpr35 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3451803 1.0 ug DNA
EUR 154

Gpr35 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3451804 1.0 ug DNA
EUR 154

Gpr35 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6273302 1.0 ug DNA
EUR 154

Gpr35 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6273303 1.0 ug DNA
EUR 154

Gpr35 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6273304 1.0 ug DNA
EUR 154

GPR35 Protein Vector (Human) (pPB-C-His)

PV052769 500 ng
EUR 481

GPR35 Protein Vector (Human) (pPB-N-His)

PV052770 500 ng
EUR 481

GPR35 Protein Vector (Human) (pPM-C-HA)

PV052771 500 ng
EUR 481

GPR35 Protein Vector (Human) (pPM-C-His)

PV052772 500 ng
EUR 481

Recombinant G Protein Coupled Receptor 35 (GPR35)

4-RPG725Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.7kDa
  • Isoelectric Point: 9.3
Description: Recombinant Human G Protein Coupled Receptor 35 expressed in: E.coli

GPR35 Protein Vector (Mouse) (pPB-C-His)

PV186178 500 ng
EUR 603

GPR35 Protein Vector (Mouse) (pPB-N-His)

PV186179 500 ng
EUR 603

GPR35 Protein Vector (Mouse) (pPM-C-HA)

PV186180 500 ng
EUR 603

GPR35 Protein Vector (Mouse) (pPM-C-His)

PV186181 500 ng
EUR 603

GPR35 Protein Vector (Mouse) (pPB-C-His)

PV186182 500 ng
EUR 603

GPR35 Protein Vector (Mouse) (pPB-N-His)

PV186183 500 ng
EUR 603

GPR35 Protein Vector (Mouse) (pPM-C-HA)

PV186184 500 ng
EUR 603

GPR35 Protein Vector (Mouse) (pPM-C-His)

PV186185 500 ng
EUR 603

GPR35 Protein Vector (Rat) (pPB-C-His)

PV271226 500 ng
EUR 603

GPR35 Protein Vector (Rat) (pPB-N-His)

PV271227 500 ng
EUR 603

GPR35 Protein Vector (Rat) (pPM-C-HA)

PV271228 500 ng
EUR 603

GPR35 Protein Vector (Rat) (pPM-C-His)

PV271229 500 ng
EUR 603

Gpr35 3'UTR Luciferase Stable Cell Line

TU205374 1.0 ml Ask for price

Gpr35 3'UTR GFP Stable Cell Line

TU159022 1.0 ml Ask for price

GPR35 3'UTR Luciferase Stable Cell Line

TU009160 1.0 ml
EUR 1394

Gpr35 3'UTR Luciferase Stable Cell Line

TU109022 1.0 ml Ask for price

GPR35 3'UTR GFP Stable Cell Line

TU059160 1.0 ml
EUR 1394

Gpr35 3'UTR GFP Stable Cell Line

TU255374 1.0 ml Ask for price

G Protein Coupled Receptor 35 (GPR35) Monoclonal Antibody (Human), APC

4-MAG725Hu21-APC
  • EUR 358.00
  • EUR 3455.00
  • EUR 957.00
  • EUR 458.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg240~Ala309
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human G Protein Coupled Receptor 35 (GPR35). This antibody is labeled with APC.

G Protein Coupled Receptor 35 (GPR35) Monoclonal Antibody (Human), Biotinylated

4-MAG725Hu21-Biotin
  • EUR 320.00
  • EUR 2592.00
  • EUR 760.00
  • EUR 394.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg240~Ala309
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human G Protein Coupled Receptor 35 (GPR35). This antibody is labeled with Biotin.

G Protein Coupled Receptor 35 (GPR35) Monoclonal Antibody (Human), Cy3

4-MAG725Hu21-Cy3
  • EUR 435.00
  • EUR 4565.00
  • EUR 1235.00
  • EUR 569.00
  • EUR 258.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg240~Ala309
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human G Protein Coupled Receptor 35 (GPR35). This antibody is labeled with Cy3.

G Protein Coupled Receptor 35 (GPR35) Monoclonal Antibody (Human), FITC

4-MAG725Hu21-FITC
  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg240~Ala309
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human G Protein Coupled Receptor 35 (GPR35). This antibody is labeled with FITC.

G Protein Coupled Receptor 35 (GPR35) Monoclonal Antibody (Human), HRP

4-MAG725Hu21-HRP
  • EUR 327.00
  • EUR 3011.00
  • EUR 846.00
  • EUR 413.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg240~Ala309
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human G Protein Coupled Receptor 35 (GPR35). This antibody is labeled with HRP.

G Protein Coupled Receptor 35 (GPR35) Monoclonal Antibody (Human), PE

4-MAG725Hu21-PE
  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg240~Ala309
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human G Protein Coupled Receptor 35 (GPR35). This antibody is labeled with PE.

Human G Protein Coupled Receptor 35 (GPR35) Protein

20-abx653488
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

GPR35 Rabbit Polyclonal Antibody