Gentaur UK

Elisa kits

GPR22 Rabbit Polyclonal Antibody

GPR22 Rabbit Polyclonal Antibody

GPR22 Polyclonal Antibody
ES5598-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPR22 from Human/Mouse. This antibody is tested and validated for IF, WB, ELISA

GPR22 Rabbit pAb
A18313-100ul 100 ul
EUR 308

GPR22 Rabbit pAb
A18313-200ul 200 ul
EUR 459

GPR22 Rabbit pAb
A18313-20ul 20 ul
EUR 183

GPR22 Rabbit pAb
A18313-50ul 50 ul
EUR 223

GPR22 antibody
20R-GR023 50 ug
EUR 656
Description: Rabbit polyclonal GPR22 antibody

GPR22 antibody
70R-17579 50 ul
EUR 435
Description: Rabbit polyclonal GPR22 antibody

GPR22 antibody
70R-30946 100 ug
EUR 327
Description: Rabbit polyclonal GPR22 antibody

GPR22 Antibody
44918-100ul 100ul
EUR 252

GPR22 Antibody
44918-50ul 50ul
EUR 187

GPR22 Antibody
1-CSB-PA859519LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR22. Recognizes GPR22 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

GPR22 Antibody
DF2732 200ul
EUR 304
Description: GPR22 antibody detects endogenous levels of total GPR22.

GPR22 Antibody
1-CSB-PA008919
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR22. Recognizes GPR22 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/5000

GPR22 Antibody
1-CSB-PA009796GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GPR22. Recognizes GPR22 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GPR22 Antibody
ABD2732 100 ug
EUR 438

Anti-GPR22 Antibody
A14444 100ul
EUR 397
Description: Rabbit Polyclonal GPR22 Antibody. Validated in IF and tested in Human, Mouse.

GPR22 Conjugated Antibody
C44918 100ul
EUR 397

anti- GPR22 antibody
FNab03603 100µg
EUR 505.25
  • Immunogen: G protein-coupled receptor 22
  • Uniprot ID: Q99680
  • Gene ID: 2845
  • Research Area: Signal Transduction
Description: Antibody raised against GPR22

Anti-GPR22 antibody
PAab03603 100 ug
EUR 355

Anti-GPR22 antibody
STJ11100269 100 µl
EUR 277
Description: This gene is a member of the G-protein coupled receptor 1 family and encodes a multi-pass membrane protein.

Anti-GPR22 antibody
STJ93374 200 µl
EUR 197
Description: Rabbit polyclonal to GPR22.

GPR22 siRNA
20-abx918503
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR22 siRNA
20-abx918504
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR22 Antibody, HRP conjugated
1-CSB-PA859519LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR22. Recognizes GPR22 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GPR22 Antibody, FITC conjugated
1-CSB-PA859519LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR22. Recognizes GPR22 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GPR22 Antibody, Biotin conjugated
1-CSB-PA859519LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR22. Recognizes GPR22 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GPR22 Blocking Peptide
DF2732-BP 1mg
EUR 195

GPR22 cloning plasmid
CSB-CL859519HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1302
  • Sequence: ATGTGTTTTTCTCCCATTCTGGAAATCAACATGCAGTCTGAATCTAACATTACAGTGCGAGATGACATTGATGACATCAACACCAATATGTACCAACCACTATCATATCCGTTAAGCTTTCAAGTGTCTCTCACCGGATTTCTTATGTTAGAAATTGGGTTGGGACTTGGCAGCA
  • Show more
Description: A cloning plasmid for the GPR22 gene.

GPR22 ELISA KIT|Human
EF009965 96 Tests
EUR 689

Mouse GPR22 shRNA Plasmid
20-abx977896
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPR22 shRNA Plasmid
20-abx951908
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPR22 Recombinant Protein (Human)
RP039571 100 ug Ask for price

GPR22 Recombinant Protein (Rat)
RP203396 100 ug Ask for price

GPR22 Recombinant Protein (Mouse)
RP139604 100 ug Ask for price

G Protein Coupled Receptor 22 (GPR22) Antibody
20-abx112636
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

G Protein Coupled Receptor 22 (GPR22) Antibody
20-abx148208
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein Coupled Receptor 22 (GPR22) Antibody
abx233603-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

G Protein Coupled Receptor 22 (GPR22) Antibody
20-abx325141
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein Coupled Receptor 22 (GPR22) Antibody
20-abx318088
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gpr22 ORF Vector (Rat) (pORF)
ORF067800 1.0 ug DNA
EUR 506

GPR22 ORF Vector (Human) (pORF)
ORF013191 1.0 ug DNA
EUR 354

Gpr22 ORF Vector (Mouse) (pORF)
ORF046536 1.0 ug DNA
EUR 506

G Protein Coupled Receptor 22 (GPR22) Antibody (HRP)
20-abx316510
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein Coupled Receptor 22 (GPR22) Antibody (FITC)
20-abx316511
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein Coupled Receptor 22 (GPR22) Antibody (Biotin)
20-abx316512
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gpr22 sgRNA CRISPR Lentivector set (Rat)
K6427401 3 x 1.0 ug
EUR 339

Gpr22 sgRNA CRISPR Lentivector set (Mouse)
K4026201 3 x 1.0 ug
EUR 339

GPR22 sgRNA CRISPR Lentivector set (Human)
K0889901 3 x 1.0 ug
EUR 339

Gpr22 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6427402 1.0 ug DNA
EUR 154

Gpr22 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6427403 1.0 ug DNA
EUR 154

Gpr22 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6427404 1.0 ug DNA
EUR 154

Gpr22 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4026202 1.0 ug DNA
EUR 154

Gpr22 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4026203 1.0 ug DNA
EUR 154

Gpr22 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4026204 1.0 ug DNA
EUR 154

GPR22 sgRNA CRISPR Lentivector (Human) (Target 1)
K0889902 1.0 ug DNA
EUR 154

GPR22 sgRNA CRISPR Lentivector (Human) (Target 2)
K0889903 1.0 ug DNA
EUR 154

GPR22 sgRNA CRISPR Lentivector (Human) (Target 3)
K0889904 1.0 ug DNA
EUR 154

GPR22 3'UTR Luciferase Stable Cell Line
TU009151 1.0 ml
EUR 1394

Gpr22 3'UTR Luciferase Stable Cell Line
TU109014 1.0 ml Ask for price

Gpr22 3'UTR Luciferase Stable Cell Line
TU205366 1.0 ml Ask for price

Gpr22 3'UTR GFP Stable Cell Line
TU159014 1.0 ml Ask for price

Gpr22 3'UTR GFP Stable Cell Line
TU255366 1.0 ml Ask for price

GPR22 3'UTR GFP Stable Cell Line
TU059151 1.0 ml
EUR 1394

GPR22 Protein Vector (Rat) (pPB-C-His)
PV271198 500 ng
EUR 603

GPR22 Protein Vector (Rat) (pPB-N-His)
PV271199 500 ng
EUR 603

GPR22 Protein Vector (Rat) (pPM-C-HA)
PV271200 500 ng
EUR 603

GPR22 Protein Vector (Rat) (pPM-C-His)
PV271201 500 ng
EUR 603

GPR22 Protein Vector (Mouse) (pPB-C-His)
PV186142 500 ng
EUR 603

GPR22 Protein Vector (Mouse) (pPB-N-His)
PV186143 500 ng
EUR 603

GPR22 Protein Vector (Mouse) (pPM-C-HA)
PV186144 500 ng
EUR 603

GPR22 Protein Vector (Mouse) (pPM-C-His)
PV186145 500 ng
EUR 603

GPR22 Protein Vector (Human) (pPB-C-His)
PV052761 500 ng
EUR 481

GPR22 Protein Vector (Human) (pPB-N-His)
PV052762 500 ng
EUR 481

GPR22 Protein Vector (Human) (pPM-C-HA)
PV052763 500 ng
EUR 481

GPR22 Protein Vector (Human) (pPM-C-His)
PV052764 500 ng
EUR 481

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

GPR22 Rabbit Polyclonal Antibody