GPR20 Rabbit Polyclonal Antibody

GPR20 Rabbit Polyclonal Antibody

GPR20 antibody

20R-GR020 50 ug
EUR 656
Description: Rabbit polyclonal GPR20 antibody

GPR20 antibody

20R-GR021 50 ug
EUR 656
Description: Rabbit polyclonal GPR20 antibody

GPR20 antibody

70R-30945 100 ug
EUR 327
Description: Rabbit polyclonal GPR20 antibody

GPR20 Antibody

44916-100ul 100ul
EUR 252

GPR20 Antibody

44916-50ul 50ul
EUR 187

GPR20 Antibody

DF2730 200ul
EUR 304
Description: GPR20 antibody detects endogenous levels of total GPR20.

GPR20 antibody

70R-49810 100 ul
EUR 244
Description: Purified Polyclonal GPR20 antibody

GPR20 Antibody

1-CSB-PA008916
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR20. Recognizes GPR20 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

GPR20 Antibody

ABD2730 100 ug
EUR 438

Polyclonal GPR20 Antibody (N-Terminus)

APR12214G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR20 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GPR20 Antibody (aa291-340)

AMM05964G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR20 (aa291-340). This antibody is tested and proven to work in the following applications:

Polyclonal GPR20 Antibody (C-Terminus)

AMM05965G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR20 (C-Terminus). This antibody is tested and proven to work in the following applications:

Anti-GPR20 Antibody

A14205 100ul
EUR 397
Description: Rabbit Polyclonal GPR20 Antibody. Validated in IF, IHC, WB and tested in Human.

GPR20 Conjugated Antibody

C44916 100ul
EUR 397

Anti-GPR20 antibody

STJ93373 200 µl
EUR 197
Description: Rabbit polyclonal to GPR20.

GPR20 siRNA

20-abx918499
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR20 siRNA

20-abx918500
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR20 Blocking Peptide

DF2730-BP 1mg
EUR 195

GPR20 Blocking Peptide

20-abx062685
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

GPR20 cloning plasmid

CSB-CL860774HU-10ug 10ug
EUR 411
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1077
  • Sequence: atgccctctgtgtctccagcggggccctcggccggggcagtccccaatgccaccgcagtgacaacagtgcggaccaatgccagcgggctggaggtgcccctgttccacctgtttgcccggctggacgaggagctgcatggcaccttcccaggcctgtggctggcgctgatggcgg
  • Show more
Description: A cloning plasmid for the GPR20 gene.

Human GPR20 shRNA Plasmid

20-abx951906
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GPR20 shRNA Plasmid

20-abx982395
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPR20 Recombinant Protein (Human)

RP039568 100 ug Ask for price

GPR20 Recombinant Protein (Rat)

RP203390 100 ug Ask for price

GPR20 Recombinant Protein (Mouse)

RP139598 100 ug Ask for price

G-Protein Coupled Receptor 20 (GPR20) Antibody

20-abx009202
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 20 (GPR20) Antibody

20-abx015323
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 20 (GPR20) Antibody

20-abx147560
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 20 (GPR20) Antibody

abx029913-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 20 (GPR20) Antibody

abx029913-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 20 (GPR20) Antibody

20-abx324935
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gpr20 ORF Vector (Rat) (pORF)

ORF067798 1.0 ug DNA
EUR 506

GPR20 ORF Vector (Human) (pORF)

ORF013190 1.0 ug DNA
EUR 354

Gpr20 ORF Vector (Mouse) (pORF)

ORF046534 1.0 ug DNA
EUR 506

Gpr20 sgRNA CRISPR Lentivector set (Rat)

K6909301 3 x 1.0 ug
EUR 339

Gpr20 sgRNA CRISPR Lentivector set (Mouse)

K4509501 3 x 1.0 ug
EUR 339

GPR20 sgRNA CRISPR Lentivector set (Human)

K0889701 3 x 1.0 ug
EUR 339

Gpr20 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6909302 1.0 ug DNA
EUR 154

Gpr20 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6909303 1.0 ug DNA
EUR 154

Gpr20 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6909304 1.0 ug DNA
EUR 154

Gpr20 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4509502 1.0 ug DNA
EUR 154

Gpr20 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4509503 1.0 ug DNA
EUR 154

Gpr20 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4509504 1.0 ug DNA
EUR 154

GPR20 sgRNA CRISPR Lentivector (Human) (Target 1)

K0889702 1.0 ug DNA
EUR 154

GPR20 sgRNA CRISPR Lentivector (Human) (Target 2)

K0889703 1.0 ug DNA
EUR 154

GPR20 sgRNA CRISPR Lentivector (Human) (Target 3)

K0889704 1.0 ug DNA
EUR 154

GPR20 3'UTR Luciferase Stable Cell Line

TU009149 1.0 ml
EUR 1394

Gpr20 3'UTR Luciferase Stable Cell Line

TU109012 1.0 ml Ask for price

Gpr20 3'UTR Luciferase Stable Cell Line

TU205364 1.0 ml Ask for price

Gpr20 3'UTR GFP Stable Cell Line

TU159012 1.0 ml Ask for price

Gpr20 3'UTR GFP Stable Cell Line

TU255364 1.0 ml Ask for price

GPR20 3'UTR GFP Stable Cell Line

TU059149 1.0 ml
EUR 1394

GPR20 Protein Vector (Rat) (pPB-C-His)

PV271190 500 ng
EUR 603

GPR20 Protein Vector (Rat) (pPB-N-His)

PV271191 500 ng
EUR 603

GPR20 Protein Vector (Rat) (pPM-C-HA)

PV271192 500 ng
EUR 603

GPR20 Protein Vector (Rat) (pPM-C-His)

PV271193 500 ng
EUR 603

GPR20 Protein Vector (Mouse) (pPB-C-His)

PV186134 500 ng
EUR 603

GPR20 Protein Vector (Mouse) (pPB-N-His)

PV186135 500 ng
EUR 603

GPR20 Protein Vector (Mouse) (pPM-C-HA)

PV186136 500 ng
EUR 603

GPR20 Protein Vector (Mouse) (pPM-C-His)

PV186137 500 ng
EUR 603

GPR20 Protein Vector (Human) (pPB-C-His)

PV052757 500 ng
EUR 481

GPR20 Protein Vector (Human) (pPB-N-His)

PV052758 500 ng
EUR 481

GPR20 Protein Vector (Human) (pPM-C-HA)

PV052759 500 ng
EUR 481

GPR20 Protein Vector (Human) (pPM-C-His)

PV052760 500 ng
EUR 481

GPR20 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV625435 1.0 ug DNA
EUR 682

GPR20 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV625439 1.0 ug DNA
EUR 682

GPR20 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV625440 1.0 ug DNA
EUR 682

Human G- protein coupled receptor 20, GPR20 ELISA KIT

ELI-43665h 96 Tests
EUR 824

Mouse G- protein coupled receptor 20, Gpr20 ELISA KIT

ELI-39001m 96 Tests
EUR 865

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

GPR20 Rabbit Polyclonal Antibody