GPR18 Rabbit Polyclonal Antibody

GPR18 Rabbit Polyclonal Antibody

GPR18 Polyclonal Antibody

ABP51461-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR18 at AA range: 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of GPR18 from Human. This GPR18 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR18 at AA range: 100-180

GPR18 Polyclonal Antibody

ABP54594-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR18 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR18 from Human, Mouse, Rat. This GPR18 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR18 at AA rangle: 160-240

GPR18 Polyclonal Antibody

ABP54594-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR18 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR18 from Human, Mouse, Rat. This GPR18 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR18 at AA rangle: 160-240

GPR18 Polyclonal Antibody

ABP54594-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR18 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR18 from Human, Mouse, Rat. This GPR18 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR18 at AA rangle: 160-240

GPR18 Polyclonal Antibody

A59294 100 µg
EUR 570.55
Description: reagents widely cited

GPR18 Polyclonal Antibody

ES5593-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPR18 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

GPR18 Polyclonal Antibody

ES5593-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPR18 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

GPR18 Polyclonal Antibody

ES2460-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPR18 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR18 Polyclonal Antibody

ES2460-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPR18 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR18 Polyclonal Conjugated Antibody

C44280 100ul
EUR 397

GPR18 Rabbit pAb

A18363-100ul 100 ul
EUR 308

GPR18 Rabbit pAb

A18363-200ul 200 ul
EUR 459

GPR18 Rabbit pAb

A18363-20ul 20 ul
EUR 183

GPR18 Rabbit pAb

A18363-50ul 50 ul
EUR 223

GPR18 antibody

20R-GR046 50 ug
EUR 656
Description: Rabbit polyclonal GPR18 antibody

GPR18 antibody

20R-GR074 50 ug
EUR 656
Description: Rabbit polyclonal GPR18 antibody

GPR18 antibody

20R-GR075 50 ug
EUR 656
Description: Rabbit polyclonal GPR18 antibody

GPR18 antibody

70R-10503 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GPR18 antibody

GPR18 antibody

70R-30943 100 ug
EUR 327
Description: Rabbit polyclonal GPR18 antibody

GPR18 antibody

70R-31413 100 ug
EUR 327
Description: Rabbit polyclonal GPR18 antibody

GPR18 antibody

44280-100ul 100ul
EUR 252

GPR18 antibody

44280-50ul 50ul
EUR 187

GPR18 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR18. Recognizes GPR18 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/40000

GPR18 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR18. Recognizes GPR18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

GPR18 Antibody

DF4904 200ul
EUR 304
Description: GPR18 Antibody detects endogenous levels of total GPR18.

GPR18 antibody

70R-49807 100 ul
EUR 244
Description: Purified Polyclonal GPR18 antibody

GPR18 antibody

70R-49808 100 ul
EUR 244
Description: Purified Polyclonal GPR18 antibody

GPR18 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR18. Recognizes GPR18 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

GPR18 Antibody

ABD4904 100 ug
EUR 438

Polyclonal GPCRW / GPR18 Antibody (Internal)

APC00054G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPCRW / GPR18 (Internal). This antibody is tested and proven to work in the following applications:

GPR18 Polyclonal Antibody, Biotin Conjugated

A59295 100 µg
EUR 570.55
Description: Ask the seller for details

GPR18 Polyclonal Antibody, FITC Conjugated

A59296 100 µg
EUR 570.55
Description: The best epigenetics products

GPR18 Polyclonal Antibody, HRP Conjugated

A59297 100 µg
EUR 570.55
Description: kits suitable for this type of research

Polyclonal GPCRW / GPR18 Antibody (Cytoplasmic Domain)

APR12199G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPCRW / GPR18 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPCRW / GPR18 Antibody (Extracellular Domain)

APR12200G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPCRW / GPR18 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPCRW / GPR18 Antibody (Extracellular Domain)

APR12201G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPCRW / GPR18 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

GPR18 Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GPR18 Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GPR18 Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-GPR18 antibody

STJ11100316 100 µl
EUR 277

Anti-GPR18 antibody

STJ93369 200 µl
EUR 197
Description: Rabbit polyclonal to GPR18.

Anti-GPR18 antibody

STJ93370 200 µl
EUR 197
Description: GPR18 is a protein encoded by the GPR18 gene which is approximately 38,1 kDa. GPR18 is localised to the cell membrane. It is involved in peptide ligand-binding receptors and signalling by GPCR. The activity of this receptor is mediated by G proteins which inhibit adenylyl cyclase. It may contribute to the regulation of the immune system and plays a role in hypotensive responses, mediating reduction in intraocular and blood pressure. GPR18 is most abundant in the testis and spleen. STJ93370 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody detects endogenous levels of GPR18 protein.

Gpr18/ Rat Gpr18 ELISA Kit

ELI-27867r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR18 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR18. Recognizes GPR18 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GPR18 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR18. Recognizes GPR18 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GPR18 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR18. Recognizes GPR18 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GPR18 Blocking Peptide

33R-3661 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GPR18 antibody, catalog no. 70R-10503

GPR18 Blocking Peptide

DF4904-BP 1mg
EUR 195

GPR18 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

GPR18 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

GPR18 cloning plasmid

CSB-CL614525HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 996
  • Sequence: atgatcaccctgaacaatcaagatcaacctgtcccttttaacagctcacatccagatgaatacaaaattgcagcccttgtcttctatagctgtatcttcataattggattatttgttaacatcactgcattatgggttttcagttgtaccaccaagaagagaaccacggtaaccat
  • Show more
Description: A cloning plasmid for the GPR18 gene.


PVT12812 2 ug
EUR 391

Rat GPR18 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPR18 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GPR18 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPR18 Recombinant Protein (Human)

RP013837 100 ug Ask for price

GPR18 Recombinant Protein (Rat)

RP203375 100 ug Ask for price

GPR18 Recombinant Protein (Mouse)

RP139562 100 ug Ask for price

G-Protein Coupled Receptor 18 (GPR18) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 18 (GPR18) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 18 (GPR18) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 18 (GPR18) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 18 (GPR18) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 18 (GPR18) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gpr18 ORF Vector (Rat) (pORF)

ORF067793 1.0 ug DNA
EUR 506

GPR18 ORF Vector (Human) (pORF)

ORF004613 1.0 ug DNA
EUR 95

Gpr18 ORF Vector (Mouse) (pORF)

ORF046522 1.0 ug DNA
EUR 506

Gpr18 sgRNA CRISPR Lentivector set (Rat)

K7498301 3 x 1.0 ug
EUR 339

Gpr18 sgRNA CRISPR Lentivector set (Mouse)

K3144201 3 x 1.0 ug
EUR 339

GPR18 sgRNA CRISPR Lentivector set (Human)

K0889501 3 x 1.0 ug
EUR 339

Gpr18 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7498302 1.0 ug DNA
EUR 154

Gpr18 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7498303 1.0 ug DNA
EUR 154

Gpr18 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7498304 1.0 ug DNA
EUR 154

Gpr18 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3144202 1.0 ug DNA
EUR 154

Gpr18 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3144203 1.0 ug DNA
EUR 154

Gpr18 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3144204 1.0 ug DNA
EUR 154

GPR18 sgRNA CRISPR Lentivector (Human) (Target 1)

K0889502 1.0 ug DNA
EUR 154

GPR18 sgRNA CRISPR Lentivector (Human) (Target 2)

K0889503 1.0 ug DNA
EUR 154

GPR18 sgRNA CRISPR Lentivector (Human) (Target 3)

K0889504 1.0 ug DNA
EUR 154

GPR18 3'UTR Luciferase Stable Cell Line

TU009147 1.0 ml
EUR 1394

Gpr18 3'UTR Luciferase Stable Cell Line

TU109007 1.0 ml Ask for price

Gpr18 3'UTR Luciferase Stable Cell Line

TU205359 1.0 ml Ask for price

Gpr18 3'UTR GFP Stable Cell Line

TU159007 1.0 ml Ask for price

Gpr18 3'UTR GFP Stable Cell Line

TU255359 1.0 ml Ask for price

GPR18 3'UTR GFP Stable Cell Line

TU059147 1.0 ml
EUR 1394

GPR18 Protein Vector (Rat) (pPB-C-His)

PV271170 500 ng
EUR 603

GPR18 Protein Vector (Rat) (pPB-N-His)

PV271171 500 ng
EUR 603

GPR18 Protein Vector (Rat) (pPM-C-HA)

PV271172 500 ng
EUR 603

GPR18 Protein Vector (Rat) (pPM-C-His)

PV271173 500 ng
EUR 603

GPR18 Protein Vector (Mouse) (pPB-C-His)

PV186086 500 ng
EUR 603

GPR18 Protein Vector (Mouse) (pPB-N-His)

PV186087 500 ng
EUR 603

GPR18 Protein Vector (Mouse) (pPM-C-HA)

PV186088 500 ng
EUR 603

GPR18 Protein Vector (Mouse) (pPM-C-His)

PV186089 500 ng
EUR 603

GPR18 Protein Vector (Human) (pPB-C-His)

PV018449 500 ng
EUR 329

GPR18 Rabbit Polyclonal Antibody