GPR1 Rabbit Polyclonal Antibody

GPR1 Rabbit Polyclonal Antibody

GPR1 Polyclonal Antibody

ES5574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPR1 from Human/Mouse/Rat. This antibody is tested and validated for IF, WB, ELISA

GPR1 Polyclonal Antibody

ES5574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPR1 from Human/Mouse/Rat. This antibody is tested and validated for IF, WB, ELISA

GPR1 antibody

20R-GR054 50 ug
EUR 656
Description: Rabbit polyclonal GPR1 antibody

GPR1 antibody

70R-30939 100 ug
EUR 327
Description: Rabbit polyclonal GPR1 antibody

GPR1 Antibody

44909-100ul 100ul
EUR 252

GPR1 Antibody

44909-50ul 50ul
EUR 187

GPR1 Antibody

44966-100ul 100ul
EUR 252

GPR1 Antibody

44966-50ul 50ul
EUR 187

GPR1 Antibody

DF2720 200ul
EUR 304
Description: GPR1 antibody detects endogenous levels of total GPR1.

GPR1 Antibody

DF2801 200ul
EUR 304
Description: GPR1 antibody detects endogenous levels of total GPR1.

GPR1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR1. Recognizes GPR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/5000

GPR1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR1. Recognizes GPR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

GPR1 Antibody

ABD2720 100 ug
EUR 438

GPR1 Antibody

ABD2801 100 ug
EUR 438

Polyclonal GPR1 Antibody (C-Terminus)

APR16470G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GPR1 Antibody (C-Terminus)

APR16471G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GPR1 Antibody (Cytoplasmic Domain)

APR16472G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR1 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR1 Antibody (N-Terminus)

APR16473G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR1 (N-Terminus). This antibody is tested and proven to work in the following applications:

GPR1 Polyclonal Antibody, HRP Conjugated

A68544 100 ?g
EUR 628.55
Description: The best epigenetics products

GPR1 Polyclonal Antibody, FITC Conjugated

A68545 100 ?g
EUR 628.55
Description: kits suitable for this type of research

GPR1 Polyclonal Antibody, Biotin Conjugated

A68546 100 ?g
EUR 628.55
Description: fast delivery possible

Gpr1/ Rat Gpr1 ELISA Kit

ELI-32658r 96 Tests
EUR 886

Anti-GPR1 Antibody

A07199 100ul
EUR 397
Description: Rabbit Polyclonal GPR1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

GPR1 Conjugated Antibody

C44909 100ul
EUR 397

GPR1 Conjugated Antibody

C44966 100ul
EUR 397

Anti-GPR1 antibody

STJ93310 200 µl
EUR 197
Description: Rabbit polyclonal to GPR1.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA12102 50 ug
EUR 363
Description: Mouse polyclonal to GPR1

GPR1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR1. Recognizes GPR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GPR1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR1. Recognizes GPR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GPR1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR1. Recognizes GPR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GPR1 Blocking Peptide

DF2720-BP 1mg
EUR 195

GPR1 Blocking Peptide

DF2801-BP 1mg
EUR 195

GPR1 cloning plasmid

CSB-CL009728HU-10ug 10ug
EUR 409
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1068
  • Sequence: atggaagatttggaggaaacattatttgaagaatttgagaactattcctatgacctagactattactctctggagtctgatttggaggagaaagtccagctgggagttgttcactgggtctccctggtgttatattgtttggcttttgttctgggaattccaggaaatgccatcg
  • Show more
Description: A cloning plasmid for the GPR1 gene.

Rat GPR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GPR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPR1 Recombinant Protein (Human)

RP013780 100 ug Ask for price

GPR1 Recombinant Protein (Rat)

RP203261 100 ug Ask for price

GPR1 Recombinant Protein (Mouse)

RP139385 100 ug Ask for price

G-Protein Coupled Receptor 1 (GPR1) Antibody

abx147336-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 1 (GPR1) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 1 (GPR1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 1 (GPR1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gpr1 ORF Vector (Rat) (pORF)

ORF067755 1.0 ug DNA
EUR 506

GPR1 ORF Vector (Human) (pORF)

ORF004594 1.0 ug DNA
EUR 95

Gpr1 ORF Vector (Mouse) (pORF)

ORF046463 1.0 ug DNA
EUR 506

G Protein-Coupled Receptor 1 (GPR1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 1 (GPR1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 1 (GPR1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gpr1 sgRNA CRISPR Lentivector set (Mouse)

K4910701 3 x 1.0 ug
EUR 339

Gpr1 sgRNA CRISPR Lentivector set (Rat)

K6821201 3 x 1.0 ug
EUR 339

GPR1 sgRNA CRISPR Lentivector set (Human)

K0888801 3 x 1.0 ug
EUR 339

Gpr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4910702 1.0 ug DNA
EUR 154

Gpr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4910703 1.0 ug DNA
EUR 154

Gpr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4910704 1.0 ug DNA
EUR 154

Gpr1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6821202 1.0 ug DNA
EUR 154

Gpr1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6821203 1.0 ug DNA
EUR 154

Gpr1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6821204 1.0 ug DNA
EUR 154

GPR1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0888802 1.0 ug DNA
EUR 154

GPR1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0888803 1.0 ug DNA
EUR 154

GPR1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0888804 1.0 ug DNA
EUR 154

GPR1 Protein Vector (Rat) (pPB-C-His)

PV271018 500 ng
EUR 603

GPR1 Protein Vector (Rat) (pPB-N-His)

PV271019 500 ng
EUR 603

GPR1 Protein Vector (Rat) (pPM-C-HA)

PV271020 500 ng
EUR 603

GPR1 Protein Vector (Rat) (pPM-C-His)

PV271021 500 ng
EUR 603

GPR1 Protein Vector (Mouse) (pPB-C-His)

PV185850 500 ng
EUR 603

GPR1 Protein Vector (Mouse) (pPB-N-His)

PV185851 500 ng
EUR 603

GPR1 Protein Vector (Mouse) (pPM-C-HA)

PV185852 500 ng
EUR 603

GPR1 Protein Vector (Mouse) (pPM-C-His)

PV185853 500 ng
EUR 603

GPR1 Protein Vector (Human) (pPB-C-His)

PV018373 500 ng
EUR 329

GPR1 Protein Vector (Human) (pPB-N-His)

PV018374 500 ng
EUR 329

GPR1 Protein Vector (Human) (pPM-C-HA)

PV018375 500 ng
EUR 329

GPR1 Protein Vector (Human) (pPM-C-His)

PV018376 500 ng
EUR 329

Gpr1 3'UTR Luciferase Stable Cell Line

TU108957 1.0 ml Ask for price

Gpr1 3'UTR Luciferase Stable Cell Line

TU205314 1.0 ml Ask for price

Gpr1 3'UTR GFP Stable Cell Line

TU158957 1.0 ml Ask for price

Gpr1 3'UTR GFP Stable Cell Line

TU255314 1.0 ml Ask for price

GPR1 3'UTR GFP Stable Cell Line

TU059140 1.0 ml
EUR 1394

GPR1 3'UTR Luciferase Stable Cell Line

TU009140 1.0 ml
EUR 1394

GPR1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV625189 1.0 ug DNA
EUR 682

GPR1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV625193 1.0 ug DNA
EUR 682

GPR1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV625194 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

GPR1 Rabbit Polyclonal Antibody