GPR1 Rabbit Polyclonal Antibody

GPR1 Rabbit Polyclonal Antibody

GPR1 Polyclonal Antibody

ABP54575-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR1 at AA rangle: 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of GPR1 from Human, Mouse, Rat. This GPR1 antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR1 at AA rangle: 90-170

GPR1 Polyclonal Antibody

A68543 100 ?g
EUR 628.55
Description: Ask the seller for details

GPR1 antibody

70R-30939 100 ug
EUR 327
Description: Rabbit polyclonal GPR1 antibody

GPR1 Antibody

ABD2720 100 ug
EUR 438

GPR1 Antibody

ABD2801 100 ug
EUR 438

GPR1 Antibody

44909-100ul 100ul
EUR 252

GPR1 Antibody

44909-50ul 50ul
EUR 187

GPR1 Antibody

44966-100ul 100ul
EUR 252

GPR1 Antibody

44966-50ul 50ul
EUR 187

GPR1 antibody

20R-GR054 50 ug
EUR 656
Description: Rabbit polyclonal GPR1 antibody

GPR1 Antibody

DF2720 200ul
EUR 304
Description: GPR1 antibody detects endogenous levels of total GPR1.

GPR1 Antibody

DF2801 200ul
EUR 304
Description: GPR1 antibody detects endogenous levels of total GPR1.

GPR1 Antibody

1-CSB-PA008894
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR1. Recognizes GPR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/5000

GPR1 Antibody

1-CSB-PA009728LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR1. Recognizes GPR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

Polyclonal GPR1 Antibody (C-Terminus)

APR16470G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GPR1 Antibody (C-Terminus)

APR16471G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GPR1 Antibody (Cytoplasmic Domain)

APR16472G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR1 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR1 Antibody (N-Terminus)

APR16473G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR1 (N-Terminus). This antibody is tested and proven to work in the following applications:

GPR1 Polyclonal Antibody, HRP Conjugated

A68544 100 ?g
EUR 628.55
Description: The best epigenetics products

GPR1 Polyclonal Antibody, FITC Conjugated

A68545 100 ?g
EUR 628.55
Description: kits suitable for this type of research

GPR1 Polyclonal Antibody, Biotin Conjugated

A68546 100 ?g
EUR 628.55
Description: fast delivery possible

Gpr1/ Rat Gpr1 ELISA Kit

ELI-32658r 96 Tests
EUR 886

GPR1 Conjugated Antibody

C44909 100ul
EUR 397

GPR1 Conjugated Antibody

C44966 100ul
EUR 397

Anti-GPR1 Antibody

A07199 100ul
EUR 397
Description: Rabbit Polyclonal GPR1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

Anti-GPR1 antibody

STJ93310 200 µl
EUR 197
Description: Rabbit polyclonal to GPR1.

GPR1 siRNA

20-abx902282
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR1 siRNA

20-abx918497
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR1 siRNA

20-abx918498
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-GPR1

YF-PA12102 50 ug
EUR 363
Description: Mouse polyclonal to GPR1

GPR1 Antibody, HRP conjugated

1-CSB-PA009728LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR1. Recognizes GPR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GPR1 Antibody, FITC conjugated

1-CSB-PA009728LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR1. Recognizes GPR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GPR1 Antibody, Biotin conjugated

1-CSB-PA009728LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR1. Recognizes GPR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GPR1 cloning plasmid

CSB-CL009728HU-10ug 10ug
EUR 409
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1068
  • Sequence: atggaagatttggaggaaacattatttgaagaatttgagaactattcctatgacctagactattactctctggagtctgatttggaggagaaagtccagctgggagttgttcactgggtctccctggtgttatattgtttggcttttgttctgggaattccaggaaatgccatcg
  • Show more
Description: A cloning plasmid for the GPR1 gene.

GPR1 Blocking Peptide

DF2720-BP 1mg
EUR 195

GPR1 Blocking Peptide

DF2801-BP 1mg
EUR 195

Rat GPR1 shRNA Plasmid

20-abx985042
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPR1 shRNA Plasmid

20-abx951890
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GPR1 shRNA Plasmid

20-abx982488
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPR1 Recombinant Protein (Human)

RP013780 100 ug Ask for price

GPR1 Recombinant Protein (Rat)

RP203261 100 ug Ask for price

GPR1 Recombinant Protein (Mouse)

RP139385 100 ug Ask for price

G-Protein Coupled Receptor 1 (GPR1) Antibody

abx147336-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 1 (GPR1) Antibody

20-abx147341
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 1 (GPR1) Antibody

20-abx326393
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 1 (GPR1) Antibody

20-abx334172
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GPR1 ORF Vector (Human) (pORF)

ORF004594 1.0 ug DNA
EUR 95

Gpr1 ORF Vector (Rat) (pORF)

ORF067755 1.0 ug DNA
EUR 506

Gpr1 ORF Vector (Mouse) (pORF)

ORF046463 1.0 ug DNA
EUR 506

G Protein-Coupled Receptor 1 (GPR1) Antibody (HRP)

20-abx335847
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 1 (GPR1) Antibody (FITC)

20-abx335848
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 1 (GPR1) Antibody (Biotin)

20-abx335849
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GPR1 sgRNA CRISPR Lentivector set (Human)

K0888801 3 x 1.0 ug
EUR 339

Gpr1 sgRNA CRISPR Lentivector set (Mouse)

K4910701 3 x 1.0 ug
EUR 339

Gpr1 sgRNA CRISPR Lentivector set (Rat)

K6821201 3 x 1.0 ug
EUR 339

GPR1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0888802 1.0 ug DNA
EUR 154

GPR1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0888803 1.0 ug DNA
EUR 154

GPR1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0888804 1.0 ug DNA
EUR 154

Gpr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4910702 1.0 ug DNA
EUR 154

Gpr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4910703 1.0 ug DNA
EUR 154

Gpr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4910704 1.0 ug DNA
EUR 154

Gpr1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6821202 1.0 ug DNA
EUR 154

Gpr1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6821203 1.0 ug DNA
EUR 154

Gpr1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6821204 1.0 ug DNA
EUR 154

GPR1 Protein Vector (Mouse) (pPB-C-His)

PV185850 500 ng
EUR 603

GPR1 Protein Vector (Mouse) (pPB-N-His)

PV185851 500 ng
EUR 603

GPR1 Protein Vector (Mouse) (pPM-C-HA)

PV185852 500 ng
EUR 603

GPR1 Protein Vector (Mouse) (pPM-C-His)

PV185853 500 ng
EUR 603

GPR1 Protein Vector (Rat) (pPB-C-His)

PV271018 500 ng
EUR 603

GPR1 Protein Vector (Rat) (pPB-N-His)

PV271019 500 ng
EUR 603

GPR1 Protein Vector (Rat) (pPM-C-HA)

PV271020 500 ng
EUR 603

GPR1 Protein Vector (Rat) (pPM-C-His)

PV271021 500 ng
EUR 603

GPR1 Protein Vector (Human) (pPB-C-His)

PV018373 500 ng
EUR 329

GPR1 Protein Vector (Human) (pPB-N-His)

PV018374 500 ng
EUR 329

GPR1 Protein Vector (Human) (pPM-C-HA)

PV018375 500 ng
EUR 329

GPR1 Protein Vector (Human) (pPM-C-His)

PV018376 500 ng
EUR 329

Gpr1 3'UTR Luciferase Stable Cell Line

TU205314 1.0 ml Ask for price

Gpr1 3'UTR GFP Stable Cell Line

TU158957 1.0 ml Ask for price

GPR1 3'UTR Luciferase Stable Cell Line

TU009140 1.0 ml
EUR 1394

Gpr1 3'UTR Luciferase Stable Cell Line

TU108957 1.0 ml Ask for price

GPR1 3'UTR GFP Stable Cell Line

TU059140 1.0 ml
EUR 1394

Gpr1 3'UTR GFP Stable Cell Line

TU255314 1.0 ml Ask for price

GPR1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV625189 1.0 ug DNA
EUR 682

GPR1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV625193 1.0 ug DNA
EUR 682

GPR1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV625194 1.0 ug DNA
EUR 682

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

GPR1 Rabbit Polyclonal Antibody