Binding of omeprazole to protein targets identified

Binding of omeprazole to protein targets recognized by monoclonal antibodies

Omeprazole is probably the most generally used proton pump inhibitor (PPI), a category of medicines whose therapeutic mechanism of motion includes formation of a disulfide linkage to cysteine residues within the H+/Ok+ ATPase pump on gastric secretory cells.

Covalent linkage between the only sulfur group of omeprazole and chosen cysteine residues of the pump protein leads to inhibition of acid secretion within the abdomen, an impact that ameliorates gastroesophageal reflux and peptic ulcer illness. PPIs, although helpful for particular circumstances when used transiently, are related to various untoward results when used long run.

The mechanisms underlying these potential off-target results stay unclear. PPIs might, in actual fact, work together with non-canonical goal proteins (non-pump molecules) leading to sudden pathophysiological results, however few research describe off-target PPI binding. Right here, we describe profitable cloning of monoclonal antibodies towards protein-bound omeprazole. We developed and used monoclonal antibodies to characterize the protein goal vary of omeprazole, stability of omeprazole-bound proteins, and the involvement of cysteines in binding of omeprazole to targets. We display that a variety of various proteins are focused by omeprazole.

Protein complexes, detected by Western blotting, are proof against warmth, detergents, and decreasing brokers. Response of omeprazole happens with cysteine-free proteins, will not be absolutely inhibited by cysteine alkylation, happens at impartial pH, and induces protein multimerization. No less than two different clinically used PPIs, rabeprazole and tenatoprazole, are able to binding to proteins similarly.

We conclude that omeprazole binds to a number of proteins and is able to forming extremely secure complexes that aren’t depending on disulfide linkages between the drug and protein targets. Additional research made doable by these antibodies might make clear whether or not PPI-protein complexes underlie off-target untoward results of persistent PPI use. gentaur.uk

TNFRSF25 Antibody

35717-100ul 100ul
EUR 252

TNFRSF25 Antibody

1-CSB-PA839000LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNFRSF25. Recognizes TNFRSF25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

TNFRSF25 Antibody

1-CSB-PA004866
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TNFRSF25. Recognizes TNFRSF25 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

TNFRSF25 Antibody

1-CSB-PA213899
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TNFRSF25. Recognizes TNFRSF25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

TNFRSF25 siRNA

20-abx937612
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human TNFRSF25 shRNA Plasmid

20-abx955739
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TNFRSF25 ELISA KIT

ELI-40008h 96 Tests
EUR 824

TNFRSF25 Rabbit pAb

A14261-100ul 100 ul
EUR 308

TNFRSF25 Rabbit pAb

A14261-200ul 200 ul
EUR 459

TNFRSF25 Rabbit pAb

A14261-20ul 20 ul
EUR 183

TNFRSF25 Rabbit pAb

A14261-50ul 50 ul
EUR 223

TNFRSF25 Blocking Peptide

33R-3528 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TNFRSF25 antibody, catalog no. 70R-10465

TNFRSF25 Conjugated Antibody

C35717 100ul
EUR 397

TNFRSF25 cloning plasmid

CSB-CL839000HU-10ug 10ug
EUR 461
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1254
  • Sequence: atggagcagcggccgcggggctgcgcggcggtggcggcggcgctcctcctggtgctgctgggggcccgggcccagggcggcactcgtagccccaggtgtgactgtgccggtgacttccacaagaagattggtctgttttgttgcagaggctgcccagcggggcactacctgaagg
  • Show more
Description: A cloning plasmid for the TNFRSF25 gene.

TNFRSF25 Rabbit pAb

A9783-100ul 100 ul
EUR 308

TNFRSF25 Rabbit pAb

A9783-200ul 200 ul
EUR 459

TNFRSF25 Rabbit pAb

A9783-20ul 20 ul Ask for price

TNFRSF25 Rabbit pAb

A9783-50ul 50 ul Ask for price

pDONR223-TNFRSF25 Plasmid

PVTB01130-1 2 ug
EUR 356

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

TNFRSF25 ORF Vector (Human) (pORF)

ORF014787 1.0 ug DNA
EUR 354

TNFRSF25 ELISA Kit (Human) (OKBB01104)

OKBB01104 96 Wells
EUR 505
Description: Description of target: Death receptor 3 (DR3), also known as tumor necrosis factor receptor superfamily member 25 (TNFRSF25), is a cell surface receptor of the tumor necrosis factor receptor superfamily which mediates apoptotic signalling and differentiation. Knockout studies in mice suggested the role of this gene in the removal of self-reactive T cells in the thymus. Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported, most of which are potentially secreted molecules. The alternative splicing of this gene in B and T cells encounters a programmed change upon T-cell activation, which predominantly produces full-length, membrane bound isoforms, and is thought to be involved in controlling lymphocyte proliferation induced by T-cell activation. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

TNFRSF25 ELISA Kit (Human) (OKCA00847)

OKCA00847 96 Wells
EUR 833
Description: Description of target: Receptor for TNFSF12/APO3L/TWEAK. Interacts directly with the adapter TRADD. Mediates activation of NF-kappa-B and induces apoptosis. May play a role in regulating lymphocyte homeostasis. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.06 ng/mL

TNFRSF25 Antibody, HRP conjugated

1-CSB-PA839000LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNFRSF25. Recognizes TNFRSF25 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TNFRSF25 Antibody, FITC conjugated

1-CSB-PA839000LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNFRSF25. Recognizes TNFRSF25 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TNFRSF25 Antibody, Biotin conjugated

1-CSB-PA839000LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNFRSF25. Recognizes TNFRSF25 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal TNFRSF25 / DR3 Antibody

APR02680G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNFRSF25 / DR3 . This antibody is tested and proven to work in the following applications:

Polyclonal TNFRSF25 / DR3 Antibody

APR02955G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNFRSF25 / DR3 . This antibody is tested and proven to work in the following applications:

Polyclonal TNFRSF25 Antibody (Center)

APR04205G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNFRSF25 (Center). This antibody is tested and proven to work in the following applications:

ELISA kit for Human TNFRSF25/DR3

EK5755 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human TNFRSF25/DR3 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human TNFRSF25/DR3 PicoKine ELISA Kit

EK1579 96 wells
EUR 425
Description: For quantitative detection of human TNFRSF25 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

TNFRSF25 sgRNA CRISPR Lentivector set (Human)

K2416901 3 x 1.0 ug
EUR 339

Recombinant Human TNFRSF25/DR3/TNFRSF12 Protein

RP00464 10 μg
EUR 174

Polyclonal TNFRSF25 antibody - middle region

APR01898G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNFRSF25 - middle region. This antibody is tested and proven to work in the following applications:

Tnfrsf25 ORF Vector (Rat) (pORF)

ORF078025 1.0 ug DNA
EUR 506

Tnfrsf25 ORF Vector (Mouse) (pORF)

ORF060084 1.0 ug DNA
EUR 506

TNFRSF25 ELISA Kit (Mouse) (OKBB01049)

OKBB01049 96 Wells
EUR 505
Description: Description of target: Death receptor 3 (DR3), also known as tumor necrosis factor receptor superfamily member 25 (TNFRSF25), is a cell surface receptor of the tumor necrosis factor receptor superfamily which mediates apoptotic signalling and differentiation. Knockout studies in mice suggested the role of this gene in the removal of self-reactive T cells in the thymus. Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported, most of which are potentially secreted molecules. The alternative splicing of this gene in B and T cells encounters a programmed change upon T-cell activation, which predominantly produces full-length, membrane bound isoforms, and is thought to be involved in controlling lymphocyte proliferation induced by T-cell activation. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <15pg/ml

TNFRSF25 sgRNA CRISPR Lentivector (Human) (Target 1)

K2416902 1.0 ug DNA
EUR 154

TNFRSF25 sgRNA CRISPR Lentivector (Human) (Target 2)

K2416903 1.0 ug DNA
EUR 154

TNFRSF25 sgRNA CRISPR Lentivector (Human) (Target 3)

K2416904 1.0 ug DNA
EUR 154

TNFRSF25 Protein Vector (Human) (pPB-C-His)

PV059145 500 ng
EUR 481

TNFRSF25 Protein Vector (Human) (pPB-N-His)

PV059146 500 ng
EUR 481

TNFRSF25 Protein Vector (Human) (pPM-C-HA)

PV059147 500 ng
EUR 481

TNFRSF25 Protein Vector (Human) (pPM-C-His)

PV059148 500 ng
EUR 481

Polyclonal TNFRSF25 / DR3 Antibody (Extracellular Domain)

APR02518G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNFRSF25 / DR3 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal TNFRSF25 / DR3 Antibody (aa25-40)

APR02519G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNFRSF25 / DR3 (aa25-40). This antibody is tested and proven to work in the following applications:

ELISA kit for Mouse TNFRSF25/DR3

EK5714 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse TNFRSF25/DR3 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse TNFRSF25/DR3 PicoKine ELISA Kit

EK1515 96 wells
EUR 425
Description: For quantitative detection of mouse TNFRSF25 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Tnfrsf25 sgRNA CRISPR Lentivector set (Rat)

K6493001 3 x 1.0 ug
EUR 339

Tnfrsf25 sgRNA CRISPR Lentivector set (Mouse)

K3774801 3 x 1.0 ug
EUR 339

Human Tumor necrosis factor receptor superfamily member 25 (TNFRSF25)

1-CSB-EP839000HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 22.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tumor necrosis factor receptor superfamily member 25(TNFRSF25),partial expressed in E.coli

Human TNF Receptor Superfamily Member 25 (TNFRSF25) ELISA Kit

abx259548-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Recombinant Human Death Receptor 3/DR3/TNFRSF25 (C-Fc)

CJ74-10ug 10ug
EUR 141
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human Death Receptor 3/DR3/TNFRSF25 (C-Fc)

CJ74-1mg 1mg
EUR 1674
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human Death Receptor 3/DR3/TNFRSF25 (C-Fc)

CJ74-500ug 500ug
EUR 1115
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human Death Receptor 3/DR3/TNFRSF25 (C-Fc)

CJ74-50ug 50ug
EUR 303
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human TNFRSF25/ DR3/ TNFRSF12 Protein, His, E.coli-100ug

QP7891-ec-100ug 100ug
EUR 408

Recombinant Human TNFRSF25/ DR3/ TNFRSF12 Protein, His, E.coli-10ug

QP7891-ec-10ug 10ug
EUR 200

Recombinant Human TNFRSF25/ DR3/ TNFRSF12 Protein, His, E.coli-1mg

QP7891-ec-1mg 1mg
EUR 1632

Recombinant Human TNFRSF25/ DR3/ TNFRSF12 Protein, His, E.coli-200ug

QP7891-ec-200ug 200ug
EUR 634

Recombinant Human TNFRSF25/ DR3/ TNFRSF12 Protein, His, E.coli-500ug

QP7891-ec-500ug 500ug
EUR 1060

Recombinant Human TNFRSF25/ DR3/ TNFRSF12 Protein, His, E.coli-50ug

QP7891-ec-50ug 50ug
EUR 263

TNF Receptor Superfamily Member 25 (TNFRSF25) Antibody

abx412445-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

TNF Receptor Superfamily Member 25 (TNFRSF25) Antibody

abx412446-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

Monoclonal TNFRSF25 Antibody (monoclonal) (M06), Clone: 4E4

AMM04216G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TNFRSF25 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 4E4. This antibody is applicable in WB, E

Tnfrsf25 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6493002 1.0 ug DNA
EUR 154

Tnfrsf25 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6493003 1.0 ug DNA
EUR 154

Tnfrsf25 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6493004 1.0 ug DNA
EUR 154

Tnfrsf25 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3774802 1.0 ug DNA
EUR 154

Tnfrsf25 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3774803 1.0 ug DNA
EUR 154

Tnfrsf25 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3774804 1.0 ug DNA
EUR 154

TNFRSF25 Protein Vector (Rat) (pPB-C-His)

PV312098 500 ng
EUR 603

TNFRSF25 Protein Vector (Rat) (pPB-N-His)

PV312099 500 ng
EUR 603

TNFRSF25 Protein Vector (Rat) (pPM-C-HA)

PV312100 500 ng
EUR 603

TNFRSF25 Protein Vector (Rat) (pPM-C-His)

PV312101 500 ng
EUR 603

TNFRSF25 Protein Vector (Mouse) (pPB-C-His)

PV240334 500 ng
EUR 603

TNFRSF25 Protein Vector (Mouse) (pPB-N-His)

PV240335 500 ng
EUR 603

TNFRSF25 Protein Vector (Mouse) (pPM-C-HA)

PV240336 500 ng
EUR 603

TNFRSF25 Protein Vector (Mouse) (pPM-C-His)

PV240337 500 ng
EUR 603

Tnfrsf25 3'UTR Luciferase Stable Cell Line

TU120889 1.0 ml Ask for price

Tnfrsf25 3'UTR GFP Stable Cell Line

TU170889 1.0 ml Ask for price

Tnfrsf25 3'UTR Luciferase Stable Cell Line

TU222242 1.0 ml Ask for price

TNFRSF25 3'UTR GFP Stable Cell Line

TU076030 1.0 ml
EUR 1521

TNFRSF25 3'UTR Luciferase Stable Cell Line

TU026030 1.0 ml
EUR 1521

Tnfrsf25 3'UTR GFP Stable Cell Line

TU272242 1.0 ml Ask for price

TNFRSF25 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2416905 3 x 1.0 ug
EUR 376

TNFRSF25 TNF Ligand Receptor Superfamily Member 25 Recombinant Protein Human

PROTQ93038 Regular: 5ug
EUR 317
Description: TNFRSF25 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 417 amino acids (25-199) and having a molecular mass of 46.1kDa (Molecular size on SDS-PAGE will appear at approximately 40-57kDa). TNFRSF25 is fused to a 242 amino acid IgG His-Tag at C-terminus and purified by proprietary chromatographic techniques.

TNFRSF25 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV648739 1.0 ug DNA
EUR 682

TNFRSF25 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV648743 1.0 ug DNA
EUR 682

TNFRSF25 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV648744 1.0 ug DNA
EUR 682

Human Tumor necrosis factor receptor superfamily member 25(TNFRSF25) ELISA kit

CSB-EL023980HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tumor necrosis factor receptor superfamily member 25 (TNFRSF25) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tumor necrosis factor receptor superfamily member 25(TNFRSF25) ELISA kit

1-CSB-EL023980HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tumor necrosis factor receptor superfamily member 25(TNFRSF25) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

TNFRSF25 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2416906 1.0 ug DNA
EUR 167

TNFRSF25 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2416907 1.0 ug DNA
EUR 167

TNFRSF25 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2416908 1.0 ug DNA
EUR 167

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25) Antibody

20-abx178768
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25) Antibody

20-abx123774
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25) Antibody

20-abx131657
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25) Antibody

abx029478-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25) Antibody

abx029478-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25) Antibody

20-abx339116
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25) Antibody

20-abx323698
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)

4-RPD930Hu01
  • EUR 386.72
  • EUR 206.00
  • EUR 1175.20
  • EUR 458.40
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Tumor Necrosis Factor Receptor Superfamily, Member 25 expressed in: E.coli

Recombinant Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)

4-RPD930Ra01
  • EUR 377.76
  • EUR 204.00
  • EUR 1141.60
  • EUR 447.20
  • EUR 794.40
  • EUR 316.00
  • EUR 2704.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D4ADP7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Tumor Necrosis Factor Receptor Superfamily, Member 25 expressed in: E.coli

ELISA kit for Human Tumor necrosis factor receptor superfamily member 25 (TNFRSF25)

KTE60213-48T 48T
EUR 332
  • TNFRSF25has been shown to stimulate NF-kappa B activity and regulate cell apoptosis. The signal transduction of this receptor is mediated by various death domain containing adaptor proteins. Knockout studies in mice suggested the role of this gene in
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tumor necrosis factor receptor superfamily member 25 (TNFRSF25) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tumor necrosis factor receptor superfamily member 25 (TNFRSF25)

KTE60213-5platesof96wells 5 plates of 96 wells
EUR 2115
  • TNFRSF25has been shown to stimulate NF-kappa B activity and regulate cell apoptosis. The signal transduction of this receptor is mediated by various death domain containing adaptor proteins. Knockout studies in mice suggested the role of this gene in
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tumor necrosis factor receptor superfamily member 25 (TNFRSF25) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tumor necrosis factor receptor superfamily member 25 (TNFRSF25)

KTE60213-96T 96T
EUR 539
  • TNFRSF25has been shown to stimulate NF-kappa B activity and regulate cell apoptosis. The signal transduction of this receptor is mediated by various death domain containing adaptor proteins. Knockout studies in mice suggested the role of this gene in
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tumor necrosis factor receptor superfamily member 25 (TNFRSF25) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25) Protein

20-abx650536
  • EUR 537.00
  • EUR 244.00
  • EUR 1553.00
  • EUR 634.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tnfrsf25 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6493005 3 x 1.0 ug
EUR 376

Tnfrsf25 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3774805 3 x 1.0 ug
EUR 376

TNFRSF25 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV648740 1.0 ug DNA
EUR 682

TNFRSF25 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV648741 1.0 ug DNA
EUR 740

TNFRSF25 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV648742 1.0 ug DNA
EUR 740

Tnfrsf25 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6493006 1.0 ug DNA
EUR 167

Tnfrsf25 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6493007 1.0 ug DNA
EUR 167

Tnfrsf25 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6493008 1.0 ug DNA
EUR 167

Tnfrsf25 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3774806 1.0 ug DNA
EUR 167

Tnfrsf25 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3774807 1.0 ug DNA
EUR 167

Tnfrsf25 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3774808 1.0 ug DNA
EUR 167

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25) Polyclonal Antibody (Rat)

4-PAD930Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNFRSF25 (Cys38~Gly167)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25) Polyclonal Antibody (Rat), APC

4-PAD930Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNFRSF25 (Cys38~Gly167)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25). This antibody is labeled with APC.

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25) Polyclonal Antibody (Rat), Biotinylated

4-PAD930Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNFRSF25 (Cys38~Gly167)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25). This antibody is labeled with Biotin.

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25) Polyclonal Antibody (Rat), Cy3

4-PAD930Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNFRSF25 (Cys38~Gly167)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25). This antibody is labeled with Cy3.

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25) Polyclonal Antibody (Rat), FITC

4-PAD930Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNFRSF25 (Cys38~Gly167)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25). This antibody is labeled with FITC.

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25) Polyclonal Antibody (Rat), HRP

4-PAD930Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNFRSF25 (Cys38~Gly167)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25). This antibody is labeled with HRP.

Anti‑EGFR monoclonal antibody 134‑mG2a exerts antitumor results in mouse xenograft fashions of oral squamous cell carcinoma

The epidermal development issue receptor (EGFR), a transmembrane receptor and member of the human epidermal development issue receptor (HER) household of receptor tyrosine kinases, is a important mediator of cell development and differentiation. EGFR types homo‑ or heterodimers with different HER members of the family to activate downstream signaling cascades in a lot of most cancers cells.

In a earlier research, the authors established an anti‑EGFR monoclonal antibody (mAb), EMab‑134, by immunizing mice with the ectodomain of human EGFR. EMab‑134 binds particularly to endogenous EGFR and can be utilized to detect receptor on oral most cancers cell strains by stream cytometry and western blot evaluation; this antibody can also be efficient for the immunohistochemical analysis of oral most cancers tissues.

Within the current research, the subclass of EMab‑134 was transformed from IgG1 to IgG2a (134‑mG2a) to facilitate antibody‑dependent mobile cytotoxicity (ADCC) and complement‑dependent cytotoxicity (CDC). The dissociation constants (KDs) of EMab‑134 and 134‑mG2a towards EGFR‑expressing CHO‑K1 (CHO/EGFR) cells had been decided by stream cytometry to be 3.2×10‑9 M and a couple of.1×10‑9 M, respectively; these outcomes point out that 134‑mG2a has a better binding affinity than EMab‑134. The 134‑mG2a antibody was extra delicate than EMab‑134 with respect to antigen detection in oral most cancers cells in each western blot evaluation and immunohistochemistry functions.

Evaluation in vitro revealed that 134‑mG2a contributed to excessive ranges of ADCC and CDC in experiments concentrating on CHO/EGFR, HSC‑2, and SAS cells. Furthermore, the in vivo administration of 134‑mG2a considerably inhibited the event of CHO/EGFR, HSC‑2, and SAS mouse xenografts compared to the outcomes noticed in response to EMab‑134. Taken collectively, the findings of the current research display that the newly‑formulated 134‑mG2a is beneficial for detecting EGFR by stream cytometry, western blot evaluation and immunohistochemistry. Moreover, the in vivo outcomes advised that it could even be helpful as a part of a therapeutic routine for sufferers with EGFR‑expressing oral most cancers.

Methods to develop extremely drug-tolerant cell-based neutralizing antibody assay: neutralizing antidrug antibodies extraction and drug depletion

Purpose: Drug interference poses nice analytical challenges for cell-based neutralizing antidrug antibodies (NAb) assay. The work aimed to enhance assay drug tolerance by biotin-drug extraction with acid dissociation methodology optimization and growing new method. 

Outcomes: The NAb extraction with biotin-drug extraction with acid dissociation method has been optimized by decreasing biotinylated drug leaching and bettering NAb elution effectivity, leading to drug tolerance of as much as 160 μg/ml. To bypass the low acid elution effectivity of NAb from drug, a novel drug depletion method was developed, which mixed acid dissociation and drug focused crosslinked seize, achieved drug tolerance as much as 400 μg/ml. Finally, a method workflow for pattern pretreatment method choice and optimization was established for bettering drug tolerance of NAb assay. 

Conclusion: We demonstrated that diminished biotinylated drug leaching and the excessive NAb elution effectivity was important for bettering assay drug tolerance. Drug depletion presents an alternate method to beat low NAb elution effectivity.

Anti-IL-8 antibody

STJ97717 200 µl
EUR 197
Description: Mouse monoclonal to IL-8.

Anti-IL-8 antibody

STJ97720 200 µl
EUR 197
Description: Mouse monoclonal to IL-8.

Anti-IL-8 antibody

STJ98175 100 µl
EUR 234
Description: Mouse monoclonal to IL-8.

Anti-IL-8 Antibody

A2062-100 100 µg
EUR 394

1730 8 SNAP-SEAL 8 OZ

1730-8 100/pk
EUR 74
Description: Disposable Plastic; Plastic Containers

mAb mouse anti-human IL-8

CT264 0.5 mg
EUR 260

Anti-IL-8 Monoclonal Antibody

A00423-1 100ul
EUR 397
Description: Mouse Monoclonal Antibody for IL-8 Antibody (CXCL8) detection. Tested with IHC in Human, Mouse, Rat.

IL-8

E5-00004 1mg
EUR 960

Swine IL-6 Recombinant Protein

R00102-8 5ug/vial
EUR 259
Description: Interleukin-6 (IL-6) is an interleukin that acts as both a pro-inflammatory and anti-inflammatory cytokine. Swine IL-6 Recombinant Protein is purified interleukin-6 produced in yeast.

Swine IL-4 Recombinant Protein

R00230-8 5ug/vial
EUR 259
Description: IL-4 has many biological roles, including the stimulation of activated B-cell and T-cell proliferation, and the differentiation of CD4+ T-cells into Th2 cells. It is a key regulator in humoral and adaptive immunity. Swine IL-4 Recombinant Protein is purified interleukin-4 produced in yeast.

Rabbit IL-2 Recombinant Protein

R00387-8 5ug/vial
EUR 259
Description: Interleukin-2 (IL-2) is a cytokine produced by T-helper cells in response to antigenic or mitogenic stimulation. It is required for T-cell proliferation and other activities crucial to the regulation of the immune response. Rabbit IL-2 Recombinant Protein is purified interleukin-2 produced in yeast.

Swine IL-17A Recombinant Protein

R00421-8 5ug/vial
EUR 259
Description: IL-17A is a member of the IL-17 family of cytokines, whose members are involved in numerous immune regulatory functions. IL-17 induces the production of many other cytokines, chemokines, and prostaglandins. Swine IL-17A Recombinant Protein is purified interleukin-17A produced in yeast.

Individual Reaction Mix 8

G065-8 200 reactions
EUR 167

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Human Interleukin-8 (IL-8) Antibody

13102-05011 150 ug
EUR 207

Ovine IL-1 beta Recombinant Protein

R00101-8 5ug/vial
EUR 259
Description: IL-1 beta (IL-1β) is a member of the interleukin 1 family of cytokines. The IL-1 beta cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1 (CASP1/ICE). This cytokine is an important mediator of the inflammatory response, and is involved in a variety of cellular activities, including cell proliferation, differentiation, and apoptosis. Ovine IL-1 beta Recombinant Protein is purified interleukin-1 beta cytokine produced in yeast.

IL-8/CXCL8, Human

HY-P7224 50ug
EUR 497

Human IL-8 Protein

abx060803-25ug 25 ug
EUR 537
  • Shipped within 5-10 working days.

Human IL-8 Protein

abx060804-25ug 25 ug
EUR 537
  • Shipped within 5-10 working days.

Human IL-8 Antibody

33486-05111 150 ug
EUR 261

Recombinant Human IL-8

P0180 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P10145
Description: Recombinant Human protein for IL-8

Recombinant Human IL-8

SJB05-01 25µg/vial
EUR 285

Anti-bovine IL-8 (CXCL8) antibody

STJ15100008 250 µg
EUR 336
Description: These monoclonal antibodies enable sensitive and specific detection of bovine IL-8 in ELISpot.

Anti-bovine IL-8 (CXCL8) antibody

STJ15100009 250 µg
EUR 336
Description: This monoclonal antibody enables sensitive and specific detection of bovine IL-8 in ELISA.

IL-8 Antibody

BF0238 200ul
EUR 376
Description: IL-8 antibody detects endogenous levels of total IL-8.

CXCL8/IL-8

E21-C97 10ug
EUR 343

CXCL8/IL-8

GT15156 100 ug
EUR 526

IL-8 Inhibitor

H-2268.0001 1.0mg
EUR 167
Description: Sum Formula: C45H66N18O7S; CAS# [138559-60-1] net

IL-8 Inhibitor

H-2268.0005 5.0mg
EUR 576
Description: Sum Formula: C45H66N18O7S; CAS# [138559-60-1] net

IL-8 Inhibitor

H-2268.0025 25.0mg
EUR 2207
Description: Sum Formula: C45H66N18O7S; CAS# [138559-60-1] net

IL-8 Inhibitor

5-01378 4 x 5mg Ask for price

IL-8 Antibody

5149-100
EUR 338

Bovine(IL-8)

QY-E60063 96T
EUR 426

IL-8, Interleukin-8, monkey

RC222-19 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Human IL-8(Interleukin 8) ELISA Kit

EH0205 96T
EUR 476.25
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P10145
  • Alias: IL-8/IL8/CXCL8/GCP-1/GCP1/LECT/LUCT/LYNAP/MDNCF/MONAP/NAF/NAP-1/NAP1/3-10C/AMCF-I/K60
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Interleukin 8(IL-8)ELISA Kit

GA-E0129HM-48T 48T
EUR 289

Human Interleukin 8(IL-8)ELISA Kit

GA-E0129HM-96T 96T
EUR 466

Human Interleukin 8 (IL-8) CLIA Kit

abx195916-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Interleukin 8,IL-8 ELISA KIT

201-12-0090 96 tests
EUR 440
  • This Interleukin 8 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 8, IL-8 ELISA KIT

CSB-E04641h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Interleukin 8, IL-8 in samples from serum, cell culture supernates, saliva, urine, cerebrospinalfluid (CSF), tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 8, IL-8 ELISA KIT

1-CSB-E04641h
  • EUR 500.00
  • EUR 3402.00
  • EUR 1820.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Interleukin 8, IL-8 in samples from serum, cell culture supernates, saliva, urine, cerebrospinalfluid(CSF), tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Interleukin-8 (IL-8) ELISA Kit

LF-EK60006 1×96T
EUR 790

Human Interleukin 8(IL-8)ELISA Kit

QY-E04259 96T
EUR 361

Bovine Cytokines IL-8(Cytokines IL-8) ELISA Kit

QY-E60102 96T
EUR 426

Human IL-8 ELISA Kit

EHI0063 96Tests
EUR 521

human IL-8 His tag

E410A07-100 100μg
EUR 960

IL-8 ELISA KIT|Human

EF003990 96 Tests
EUR 689

rec Endothelial IL-8 (human)

H-3742.0010 10.0µg
EUR 284
Description: Sum Formula: C397H644N114O111S4; CAS# [142298-01-9]

rec Endothelial IL-8 (human)

H-3742.0050 50.0µg
EUR 973
Description: Sum Formula: C397H644N114O111S4; CAS# [142298-01-9]

rec Monocyte IL-8 (human)

H-9625.0005 5.0µg
EUR 162
Description: Sum Formula: C372H600N106O106S4; CAS# [142298-00-8]

rec Monocyte IL-8 (human)

H-9625.0025 25.0µg
EUR 381
Description: Sum Formula: C372H600N106O106S4; CAS# [142298-00-8]

IL-8/CXCL8, 72a.a., Human

HY-P7380 50ug
EUR 497

IL-8 (Human) ELISA Kit

K4169-100
EUR 729

Human IL-8 ELISA kit

CT212A 5-plate
EUR 462

Human IL-8 ELISA kit

LF-EK50165 1×96T
EUR 648

Recombinant Human IL-8 Protein

RP00052 5 μg
EUR 149

Guinea pig IL-8(Interleukin 8)

EGP0055 96T
EUR 567.6
  • Detection range: 15.6-1000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Guinea pig;Sensitivity: 9.375pg/ml

Horse Interleukin 8 (IL-8) ELISA

QY-E120050 96T
EUR 478

IL-8, CXCL8, Interleukin-8, canine

RC242-19 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

IL-8, CXCL8, Interleukin-8, porcine

RC282-19 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Recombinant Human Interleukin-8/IL-8 (C-6His)

CC97-10ug 10ug
EUR 146
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Interleukin-8/IL-8 (C-6His)

CC97-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Interleukin-8/IL-8 (C-6His)

CC97-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Interleukin-8/IL-8 (C-6His)

CC97-50ug 50ug
EUR 339
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Interleukin-8/IL-8 (Ser28-Ser99)

C035-10ug 10ug
EUR 151
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Interleukin-8/IL-8 (Ser28-Ser99)

C035-1mg 1mg
EUR 1836
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Interleukin-8/IL-8 (Ser28-Ser99)

C035-500ug 500ug
EUR 1298
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Interleukin-8/IL-8 (Ser28-Ser99)

C035-50ug 50ug
EUR 354
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Interleukin-8/IL-8 (Ala23-Ser99)

C037-10ug 10ug
EUR 151
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Interleukin-8/IL-8 (Ala23-Ser99)

C037-1mg 1mg
EUR 1836
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Interleukin-8/IL-8 (Ala23-Ser99)

C037-500ug 500ug
EUR 1298
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Interleukin-8/IL-8 (Ala23-Ser99)

C037-50ug 50ug
EUR 344
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Human Interleukin-8 (IL-8) AssayMax ELISA Kit

EI1008-1 96 Well Plate
EUR 477

ELISA kit for Human Interleukin 8,IL-8

EK0240 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interleukin 8,IL-8 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Interleukin-8 (IL-8) Antibody (Biotin Conjugate)

13102-05021 150 ug
EUR 261

CLIA kit for Human IL-8 (Interleukin 8)

E-CL-H0048 1 plate of 96 wells
EUR 584
  • Gentaur's IL-8 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human IL-8 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human IL-8 (Interleukin 8) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human IL-8 (Interleukin 8)

E-EL-H0048 1 plate of 96 wells
EUR 377
  • Gentaur's IL-8 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-8. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human IL-8 (Interleukin 8) in samples from Serum, Plasma, Cell supernatant

IL-8, CXCL8, Interleukin-8 (72 a.a.), human

RC212-19A 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

IL-8, CXCL8, Interleukin-8 (77 a.a.), human

RC212-19B 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Polyclonal IL-8 Antibody

APR00274G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IL-8 . This antibody is tested and proven to work in the following applications:

IL-8 Blocking Peptide

BF0238-BP 1mg
EUR 195

IL-8 Polyclonal Antibody

ES2620-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IL-8 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

IL-8 Polyclonal Antibody

ES2620-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IL-8 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

IL-8 Polyclonal Antibody

ES5885-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IL-8 from Human. This antibody is tested and validated for IHC, WB, ELISA

IL-8 Polyclonal Antibody

ES5885-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IL-8 from Human. This antibody is tested and validated for IHC, WB, ELISA

IL-8 Polyclonal Antibody

ES3883-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IL-8 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

IL-8 Polyclonal Antibody

ES3883-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IL-8 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

IL-8 Polyclonal Antibody

ABP52884-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human IL-8
  • Applications tips:
Description: A polyclonal antibody for detection of IL-8 from Human. This IL-8 antibody is for WB, IF, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human IL-8

IL-8 Polyclonal Antibody

ABP52884-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human IL-8
  • Applications tips:
Description: A polyclonal antibody for detection of IL-8 from Human. This IL-8 antibody is for WB, IF, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human IL-8

IL-8 Polyclonal Antibody

ABP52884-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human IL-8
  • Applications tips:
Description: A polyclonal antibody for detection of IL-8 from Human. This IL-8 antibody is for WB, IF, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human IL-8

IL-8 Polyclonal Antibody

ABP51621-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human IL-8
  • Applications tips:
Description: A polyclonal antibody for detection of IL-8 from Human. This IL-8 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IL-8

IL-8 Polyclonal Antibody

ABP51621-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human IL-8
  • Applications tips:
Description: A polyclonal antibody for detection of IL-8 from Human. This IL-8 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IL-8

IL-8 Polyclonal Antibody

ABP51621-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human IL-8
  • Applications tips:
Description: A polyclonal antibody for detection of IL-8 from Human. This IL-8 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IL-8

IL-8 Polyclonal Antibody

ABP54886-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human IL-8
  • Applications tips:
Description: A polyclonal antibody for detection of IL-8 from Human. This IL-8 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IL-8

IL-8 Polyclonal Antibody

ABP54886-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human IL-8
  • Applications tips:
Description: A polyclonal antibody for detection of IL-8 from Human. This IL-8 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IL-8

IL-8 Polyclonal Antibody

ABP54886-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human IL-8
  • Applications tips:
Description: A polyclonal antibody for detection of IL-8 from Human. This IL-8 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IL-8

IL-8 Polyclonal Antibody

41063-100ul 100ul
EUR 252

IL-8 Polyclonal Antibody

41063-50ul 50ul
EUR 187

CXCR1/IL-8 RA

MO15072 500 ug
EUR 910

CXCR2/IL-8 RB

MO15073 100 ug
EUR 474

CXCR2/IL-8 RB

MO15084 100 ug
EUR 474

Recombinant Bovine IL-8

P0176 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P79255
Description: Recombinant Bovine protein for IL-8

Recombinant Chicken IL-8

P0177 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P08317
Description: Recombinant Chicken protein for IL-8

Recombinant Dog IL-8

P0178 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P41324
Description: Recombinant Dog protein for IL-8

Recombinant Pig IL-8

P0181 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P26894
Description: Recombinant Pig protein for IL-8

Recombinant Rabbit IL-8

P0272 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P19874
Description: Recombinant Rabbit protein for IL-8

Human IL-8 PicoKine ELISA Kit

EK0413 96 wells
EUR 425
Description: For quantitative detection of human IL-8 in cell culture supernates, serum and plasma(heparin, EDTA, citrate).

IL-8/CXCL8 (CHO-expressed), Human

HY-P7379 50ug
EUR 497

Human IL-8 Antibody (Biotin Conjugate)

33486-05121 150 ug
EUR 369

IL-8 (77 a.a.), human recombinant

4149-1000
EUR 3965

IL-8 (77 a.a.), human recombinant

4149-25
EUR 283

IL-8 (72 a.a.), human recombinant

4149M-1000
EUR 3965

IL-8 (72 a.a.), human recombinant

4149M-25
EUR 283

Human IL-8 ELISA antibody pair

CT748-10 10-plate
EUR 547

Human IL-8 ELISA antibody pair

CT748-20 20-plate
EUR 932

ELISA kit for Human IL-8

KET6018-48T 48T
EUR 202
  • The protein encoded by IL-8 gene is a member of the CXC chemokine family. This chemokine is one of the major mediators of the inflammatory response. This chemokine is secreted by several cell types. It functions as a chemoattractant, and is also a po
  • Show more
Description: Quantitative sandwich ELISA for measuring Human IL-8 in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human IL-8

KET6018-5platesof96wells 5 plates of 96 wells
EUR 1077
  • The protein encoded by IL-8 gene is a member of the CXC chemokine family. This chemokine is one of the major mediators of the inflammatory response. This chemokine is secreted by several cell types. It functions as a chemoattractant, and is also a po
  • Show more
Description: Quantitative sandwich ELISA for measuring Human IL-8 in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human IL-8

KET6018-96T 96T
EUR 289
  • The protein encoded by IL-8 gene is a member of the CXC chemokine family. This chemokine is one of the major mediators of the inflammatory response. This chemokine is secreted by several cell types. It functions as a chemoattractant, and is also a po
  • Show more
Description: Quantitative sandwich ELISA for measuring Human IL-8 in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

IL-8 (77 a.a.), human recombinant

P1026-.025 25 µg
EUR 300
Description: Interleukin-8 (IL-8) is a proinflammatory CXC chemokine produced by macrophages, epithelial cells. IL-8 is also synthesized by endothelial cells, which store IL-8 in their storage vesicles, the Weibel-Palade bodies

IL-8 (77 a.a.), human recombinant

P1026-1 1 mg
EUR 4226
Description: Interleukin-8 (IL-8) is a proinflammatory CXC chemokine produced by macrophages, epithelial cells. IL-8 is also synthesized by endothelial cells, which store IL-8 in their storage vesicles, the Weibel-Palade bodies

CymaxTM Human IL-8 ELISA Kit

LF-EK0262 1×96T
EUR 398

Human IL-8 ELISA kit (4X96T)

LF-EK50166 4×96T
EUR 2201

Human IL-8/CXCL8 ELISA Kit

RK00011 96 Tests
EUR 521

IL-8 ELISA Kit (Human) (OKBB00192)

OKBB00192 96 Tests
EUR 505
Description: Description of target: Interleukin-8, also called neutrophil-activating peptide-1 or SCYB8, is a tissue-derived peptide secreted by several types of cells in response to inflammatory stimuli. Monocyte-derived neutrophil chemotactic factor (MDNCF/IL-8, suggested gene symbol IL8) is a cytokine that chemoattracts and activates neutrophils.1 IL-8 is produced and released from human adipose tissue and from isolated adipocytes in vitro, which may indicate that IL-8 from adipose tissue could be involved in some of the obesity-related complications.2 The MDNCF/IL-8 gene is placed on the human gene map at position 4q12-q21. This is the same location where at least three other members (platelet factor 4, melanoma growth stimulatory activity, and interferon-gamma induced factor) of the platelet factor 4 gene superfamily reside.1 Human IL-8 consists of 99 amino acids in precursor form and 79 amino acids in mature form.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 1 pg/ml

Equine Interleukin 8, IL 8 ELISA Kit

ELA-E0080Eq 96 Tests
EUR 928

Mouse Interleukin 8, IL 8 ELISA Kit

ELA-E0080m 96 Tests
EUR 865

Porcine Interleukin 8, IL 8 ELISA Kit

ELA-E0080p 96 Tests
EUR 928

Sheep Interleukin-8,IL-8 ELISA Kit

ELA-E0080Sh 96 Tests
EUR 928

Horse IL-8(Interleukin 8) ELISA Kit

EHS0003 96T
EUR 567.6
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: O62812
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Horse;Sensitivity: 9.375pg/ml

Canine IL-8(Interleukin 8) ELISA Kit

ECA0014 96T
EUR 567.6
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: P41324
  • Alias: IL-8/IL8/CXCL8/GCP-1/GCP1/LECT/LUCT/LYNAP/MDNCF/MONAP/NAF/NAP-1/NAP1/3-10C/AMCF-I/K60
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Canine;Sensitivity: 9.375pg/ml

Chicken IL-8(Interleukin 8) ELISA Kit

ECH0047 96T
EUR 567.6
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: P08317
  • Alias: IL-8/IL8/CXCL8/GCP-1/GCP1/LECT/LUCT/LYNAP/MDNCF/MONAP/NAF/NAP-1/NAP1/3-10C/AMCF-I/K60
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Chicken;Sensitivity: 9.375pg/ml

Bovine IL-8(Interleukin 8) ELISA Kit

EB0007 96T
EUR 567.6
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: P79255
  • Alias: IL-8/IL8/CXCL8/GCP-1/GCP1/LECT/LUCT/LYNAP/MDNCF/MONAP/NAF/NAP-1/NAP1/3-10C/AMCF-I/K60
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Cattle;Sensitivity: 18.75pg/ml

Mouse interleukin 8(IL-8)ELISA Kit

GA-E0260MS-48T 48T
EUR 336

Mouse interleukin 8(IL-8)ELISA Kit

GA-E0260MS-96T 96T
EUR 534

Rabbit Interleukin 8,IL-8 ELISA Kit

GA-E0119RB-48T 48T
EUR 326

Rabbit Interleukin 8,IL-8 ELISA Kit

GA-E0119RB-96T 96T
EUR 524

Rabbit IL-8(Interleukin 8) ELISA Kit

ERB0069 96T
EUR 567.6
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P19874
  • Alias: IL-8/IL8/CXCL8/GCP-1/GCP1/LECT/LUCT/LYNAP/MDNCF/MONAP/NAF/NAP-1/NAP1/3-10C/AMCF-I/K60
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rabbit;Sensitivity: 18.75pg/ml

Leave a Reply

Your email address will not be published. Required fields are marked *