AQP11 Rabbit Polyclonal Antibody

AQP11 Rabbit Polyclonal Antibody

AQP11 Antibody

ABD9222 100 ug
EUR 438

AQP11 antibody

70R-34055 100 ug
EUR 327
Description: Rabbit polyclonal AQP11 antibody

AQP11 Antibody

43227-100ul 100ul
EUR 252

AQP11 Antibody

DF9222 200ul
EUR 304
Description: AQP11 Antibody detects endogenous levels of total AQP11.

AQP11 Antibody

1-CSB-PA781210
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AQP11. Recognizes AQP11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:20-1:100

AQP11 Antibody

1-CSB-PA008895
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AQP11. Recognizes AQP11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

Polyclonal AQP11 Antibody (C-term)

APR15000G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AQP11 (C-term). This antibody is tested and proven to work in the following applications:

Rabbit Anti-Rat Aquaporin 1 (AQP1) Antiserum #1

AQP11-S 100 ul
EUR 457

Aqp11/ Rat Aqp11 ELISA Kit

ELI-24297r 96 Tests
EUR 886

AQP11 Conjugated Antibody

C43227 100ul
EUR 397

Anti-AQP11 Antibody

PB10044 100ug/vial
EUR 294

Anti-AQP11 antibody

STJ91653 200 µl
EUR 197
Description: Rabbit polyclonal to AQP11.

Anti-AQP11 antibody

STJ13100028 100 µl
EUR 427

Rabbit Anti-Rat Aquaporin 1 (AQP1) IgG #1, aff pure

AQP11-A 100 ul
EUR 482

AQP11 siRNA

20-abx900386
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AQP11 siRNA

20-abx907880
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AQP11 siRNA

20-abx907881
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rabbit Aquaporin-11(AQP11) ELISA kit

E04A1613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aquaporin-11(AQP11) ELISA kit

E04A1613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aquaporin-11(AQP11) ELISA kit

E04A1613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Aquaporin-11 (AQP11) Antibody

abx032621-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Aquaporin-11 (AQP11) Antibody

abx032621-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Aquaporin 11 (AQP11) Antibody

20-abx327984
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Aquaporin 11 (AQP11) Antibody

20-abx210440
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

AQP11 Blocking Peptide

DF9222-BP 1mg
EUR 195

AQP11 cloning plasmid

CSB-CL847678HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 816
  • Sequence: atgtcgccgctgctggggctccggtccgagctgcaggacacctgcacctcgctgggactgatgctgtcggtggtgctgctcatggggctggcccgcgtagtcgcccggcagcagctgcacaggccggtggcccacgccttcgtcctggagtttctagccaccttccagctctgctg
  • Show more
Description: A cloning plasmid for the AQP11 gene.

Rabbit Anti-Mouse/Human AQP11 IgG, aff pure

AQP115-A 100 ug
EUR 482

Rabbit Anti-Mouse/Human AQP11 IgG, aff pure

AQP115-S 100 ug
EUR 457

Mouse AQP11 shRNA Plasmid

20-abx975546
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat AQP11 shRNA Plasmid

20-abx988146
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human AQP11 shRNA Plasmid

20-abx966847
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AQP11 Recombinant Protein (Human)

RP001639 100 ug Ask for price

pCMV-SPORT6-AQP11 Plasmid

PVT16845 2 ug
EUR 325

AQP11 Recombinant Protein (Rat)

RP190628 100 ug Ask for price

AQP11 Recombinant Protein (Mouse)

RP116588 100 ug Ask for price

Rat Aquaporin 1 (AQP1) Control/blocking peptide #1

AQP11-P 100 ug
EUR 164

AQP11 ORF Vector (Human) (pORF)

ORF000547 1.0 ug DNA
EUR 95

Aqp11 ORF Vector (Mouse) (pORF)

ORF038864 1.0 ug DNA
EUR 506

Aqp11 ORF Vector (Rat) (pORF)

ORF063544 1.0 ug DNA
EUR 506

Mouse/Human AQP11 control/blocking peptide

AQP115-P 100 ug
EUR 152

Goat Aquaporin-11(AQP11) ELISA kit

E06A1613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Aquaporin-11(AQP11) ELISA kit

E06A1613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Aquaporin-11(AQP11) ELISA kit

E06A1613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aquaporin-11(AQP11) ELISA kit

E03A1613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aquaporin-11(AQP11) ELISA kit

E03A1613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aquaporin-11(AQP11) ELISA kit

E03A1613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-11(AQP11) ELISA kit

E01A1613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-11(AQP11) ELISA kit

E01A1613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-11(AQP11) ELISA kit

E01A1613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aquaporin-11(AQP11) ELISA kit

E02A1613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aquaporin-11(AQP11) ELISA kit

E02A1613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aquaporin-11(AQP11) ELISA kit

E02A1613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aquaporin-11(AQP11) ELISA kit

E07A1613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aquaporin-11(AQP11) ELISA kit

E07A1613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aquaporin-11(AQP11) ELISA kit

E07A1613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aquaporin-11(AQP11) ELISA kit

E09A1613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aquaporin-11(AQP11) ELISA kit

E09A1613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aquaporin-11(AQP11) ELISA kit

E09A1613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Aquaporin-11(AQP11) ELISA kit

E08A1613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Aquaporin-11(AQP11) ELISA kit

E08A1613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Aquaporin-11(AQP11) ELISA kit

E08A1613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AQP11 sgRNA CRISPR Lentivector set (Human)

K0110401 3 x 1.0 ug
EUR 339

Human Aquaporin- 11, AQP11 ELISA KIT

ELI-49024h 96 Tests
EUR 824

Mouse Aquaporin- 11, Aqp11 ELISA KIT

ELI-49222m 96 Tests
EUR 865

Aqp11 sgRNA CRISPR Lentivector set (Mouse)

K4354501 3 x 1.0 ug
EUR 339

Aqp11 sgRNA CRISPR Lentivector set (Rat)

K7310901 3 x 1.0 ug
EUR 339

Human Aquaporin 11(AQP11)ELISA Kit

QY-E01460 96T
EUR 361

Guinea pig Aquaporin-11(AQP11) ELISA kit

E05A1613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Aquaporin-11(AQP11) ELISA kit

E05A1613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Aquaporin-11(AQP11) ELISA kit

E05A1613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AQP11 sgRNA CRISPR Lentivector (Human) (Target 1)

K0110402 1.0 ug DNA
EUR 154

AQP11 sgRNA CRISPR Lentivector (Human) (Target 2)

K0110403 1.0 ug DNA
EUR 154

AQP11 sgRNA CRISPR Lentivector (Human) (Target 3)

K0110404 1.0 ug DNA
EUR 154

Aqp11 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4354502 1.0 ug DNA
EUR 154

Aqp11 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4354503 1.0 ug DNA
EUR 154

Aqp11 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4354504 1.0 ug DNA
EUR 154

Aqp11 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7310902 1.0 ug DNA
EUR 154

Aqp11 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7310903 1.0 ug DNA
EUR 154

Aqp11 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7310904 1.0 ug DNA
EUR 154

AQP11 Protein Vector (Human) (pPB-C-His)

PV002185 500 ng
EUR 329

AQP11 Protein Vector (Human) (pPB-N-His)

PV002186 500 ng
EUR 329

AQP11 Protein Vector (Human) (pPM-C-HA)

PV002187 500 ng
EUR 329

AQP11 Protein Vector (Human) (pPM-C-His)

PV002188 500 ng
EUR 329

AQP11 Protein Vector (Mouse) (pPB-C-His)

PV155454 500 ng
EUR 603

AQP11 Protein Vector (Mouse) (pPB-N-His)

PV155455 500 ng
EUR 603

AQP11 Protein Vector (Mouse) (pPM-C-HA)

PV155456 500 ng
EUR 603

AQP11 Protein Vector (Mouse) (pPM-C-His)

PV155457 500 ng
EUR 603

AQP11 Protein Vector (Human) (pPB-His-MBP)

PV323002 500 ng
EUR 329

AQP11 Protein Vector (Human) (pPB-His-GST)

PV323003 500 ng
EUR 329

AQP11 Protein Vector (Rat) (pPB-C-His)

PV254174 500 ng
EUR 603

AQP11 Protein Vector (Rat) (pPB-N-His)

PV254175 500 ng
EUR 603

AQP11 Protein Vector (Rat) (pPM-C-HA)

PV254176 500 ng
EUR 603

AQP11 Protein Vector (Rat) (pPM-C-His)

PV254177 500 ng
EUR 603

Aqp11 3'UTR Luciferase Stable Cell Line

TU200789 1.0 ml Ask for price

Aqp11 3'UTR GFP Stable Cell Line

TU151994 1.0 ml Ask for price

AQP11 3'UTR Luciferase Stable Cell Line

TU001008 1.0 ml
EUR 1394

Aqp11 3'UTR Luciferase Stable Cell Line

TU101994 1.0 ml Ask for price

AQP11 3'UTR GFP Stable Cell Line

TU051008 1.0 ml
EUR 1394

Aqp11 3'UTR GFP Stable Cell Line

TU250789 1.0 ml Ask for price

AQP11 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV674941 1.0 ug DNA
EUR 514

AQP11 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV674945 1.0 ug DNA
EUR 514

AQP11 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV674946 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

AQP11 Rabbit Polyclonal Antibody