ADAMDEC1 Rabbit Polyclonal Antibody

ADAMDEC1 Rabbit Polyclonal Antibody

ADAMDEC1 Polyclonal Antibody

ABP54555-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ADAMDEC1 at AA rangle: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of ADAMDEC1 from Human. This ADAMDEC1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ADAMDEC1 at AA rangle: 10-90

ADAMDEC1 Polyclonal Antibody

A62050 100 µg
EUR 570.55
Description: Ask the seller for details

ADAMDEC1 Polyclonal Antibody

ES5554-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ADAMDEC1 from Human. This antibody is tested and validated for IHC, WB, ELISA

ADAMDEC1 Polyclonal Antibody

ES5554-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ADAMDEC1 from Human. This antibody is tested and validated for IHC, WB, ELISA

ADAMDEC1 Rabbit pAb

A15435-100ul 100 ul
EUR 308

ADAMDEC1 Rabbit pAb

A15435-200ul 200 ul
EUR 459

ADAMDEC1 Rabbit pAb

A15435-20ul 20 ul
EUR 183

ADAMDEC1 Rabbit pAb

A15435-50ul 50 ul
EUR 223

ADAMDEC1 Antibody

36047-100ul 100ul
EUR 252

ADAMDEC1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMDEC1. Recognizes ADAMDEC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

ADAMDEC1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMDEC1. Recognizes ADAMDEC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

ADAMDEC1 Antibody

DF9167 200ul
EUR 304
Description: ADAMDEC1 Antibody detects endogenous levels of total ADAMDEC1.

ADAMDEC1 antibody

70R-6062 50 ug
EUR 467
Description: Rabbit polyclonal ADAMDEC1 antibody raised against the middle region of ADAMDEC1

ADAMDEC1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMDEC1. Recognizes ADAMDEC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

ADAMDEC1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ADAMDEC1. Recognizes ADAMDEC1 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

ADAMDEC1 Antibody

ABD9167 100 ug
EUR 438

ADAMDEC1 Polyclonal Antibody, HRP Conjugated

A62051 100 µg
EUR 570.55
Description: The best epigenetics products

ADAMDEC1 Polyclonal Antibody, FITC Conjugated

A62052 100 µg
EUR 570.55
Description: kits suitable for this type of research

ADAMDEC1 Polyclonal Antibody, Biotin Conjugated

A62053 100 µg
EUR 570.55
Description: fast delivery possible

ADAMDEC1 Conjugated Antibody

C36047 100ul
EUR 397

anti- ADAMDEC1 antibody

FNab00145 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • IP: 1:50-1:500
  • Immunogen: ADAM-like, decysin 1
  • Uniprot ID: O15204
  • Gene ID: 27299
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against ADAMDEC1

Anti-ADAMDEC1 antibody

PAab00145 100 ug
EUR 355

Anti-ADAMDEC1 antibody

STJ117630 100 µl
EUR 277
Description: This encoded protein is thought to be a secreted protein belonging to the disintegrin metalloproteinase family. Its expression is upregulated during dendritic cells maturation. This protein may play an important role in dendritic cell function and their interactions with germinal center T cells.

Anti-ADAMDEC1 antibody

STJ91476 200 µl
EUR 197
Description: Rabbit polyclonal to ADAMDEC1.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA26058 50 ul
EUR 334
Description: Mouse polyclonal to ADAMDEC1


E04A1245-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E04A1245-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E04A1245-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ADAMDEC1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMDEC1. Recognizes ADAMDEC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADAMDEC1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMDEC1. Recognizes ADAMDEC1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADAMDEC1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMDEC1. Recognizes ADAMDEC1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ADAMDEC1 Blocking Peptide

33R-3436 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADAMDEC1 antibody, catalog no. 70R-6062

ADAMDEC1 Blocking Peptide

DF9167-BP 1mg
EUR 195

ADAMDEC1 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

ADAMDEC1 cloning plasmid

CSB-CL001297HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1413
  • Sequence: atgctgcgtgggatctcccagctacctgcagtggccaccatgtcttgggtcctgctgcctgtactttggctcattgttcaaactcaagcaatagccataaagcaaacacctgaattaacgctccatgaaatagtttgtcctaaaaaacttcacattttacacaaaagagagatca
  • Show more
Description: A cloning plasmid for the ADAMDEC1 gene.

Anti-ADAMDEC1 (6C4)

YF-MA11455 100 ug
EUR 363
Description: Mouse monoclonal to ADAMDEC1

Anti-ADAMDEC1 (1G2)

YF-MA18197 100 ug
EUR 363
Description: Mouse monoclonal to ADAMDEC1

ADAM Like Decysin 1 (ADAMDEC1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAM Like Decysin 1 (ADAMDEC1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAM Like Decysin 1 (ADAMDEC1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

ADAM Like Decysin 1 (ADAMDEC1) Antibody

abx037055-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ADAM Like Decysin 1 (ADAMDEC1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ADAM Like Decysin 1 (ADAMDEC1) Antibody

abx230145-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

ADAM Like Decysin 1 (ADAMDEC1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


EF007611 96 Tests
EUR 689

Mouse ADAMDEC1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ADAMDEC1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADAMDEC1 Recombinant Protein (Human)

RP000526 100 ug Ask for price

ADAMDEC1 Recombinant Protein (Mouse)

RP114281 100 ug Ask for price

ADAMDEC1 Recombinant Protein (Rat)

RP189179 100 ug Ask for price

ADAM Like Decysin 1 (ADAMDEC1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ADAM Like Decysin 1 (ADAMDEC1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ADAM Like Decysin 1 (ADAMDEC1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal ADAMDEC1 Antibody (monoclonal) (M01), Clone: 6C4

AMM03240G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ADAMDEC1 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 6C4. This antibody is applicable in WB and IHC, E

Monoclonal ADAMDEC1 Antibody (monoclonal) (M03), Clone: 1G2

AMM03241G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ADAMDEC1 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 1G2. This antibody is applicable in WB, E

Adamdec1 ORF Vector (Rat) (pORF)

ORF063061 1.0 ug DNA
EUR 506

ADAMDEC1 ORF Vector (Human) (pORF)

ORF000176 1.0 ug DNA
EUR 95

Adamdec1 ORF Vector (Mouse) (pORF)

ORF038095 1.0 ug DNA
EUR 506

ADAMDEC1 ELISA Kit (Human) (OKCA01092)

OKCA01092 96 Wells
EUR 846
Description: Description of target: May play an important role in the control of the immune response and during pregnancy.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 15.6 pg/mL

ADAMDEC1 ELISA Kit (Mouse) (OKCA01624)

OKCA01624 96 Wells
EUR 846
Description: Description of target: May play an important role in the control of the immune response and during pregnancy. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.8 pg/mL


E02A1245-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E02A1245-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E02A1245-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E06A1245-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E06A1245-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E06A1245-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E03A1245-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E03A1245-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E03A1245-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E01A1245-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E01A1245-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E01A1245-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E08A1245-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E08A1245-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E08A1245-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E09A1245-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E09A1245-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E09A1245-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E07A1245-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E07A1245-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


E07A1245-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse ADAM DEC1, Adamdec1 ELISA KIT

ELI-11570m 96 Tests
EUR 865


CSB-EL001297HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human ADAM DEC1 (ADAMDEC1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.


  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human ADAM DEC1(ADAMDEC1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.


CSB-EL001297MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse ADAM DEC1 (ADAMDEC1) in samples from serum, plasma, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.


  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse ADAM DEC1(ADAMDEC1) in samples from serum, plasma, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.


ELI-49696h 96 Tests
EUR 824

Adamdec1 sgRNA CRISPR Lentivector set (Rat)

K6523401 3 x 1.0 ug
EUR 339

Adamdec1 sgRNA CRISPR Lentivector set (Mouse)

K3550001 3 x 1.0 ug
EUR 339

ADAMDEC1 sgRNA CRISPR Lentivector set (Human)

K0043501 3 x 1.0 ug
EUR 339

Guinea pig ADAM DEC1(ADAMDEC1) ELISA kit

E05A1245-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig ADAM DEC1(ADAMDEC1) ELISA kit

E05A1245-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig ADAM DEC1(ADAMDEC1) ELISA kit

E05A1245-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig ADAM DEC1(ADAMDEC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human ADAM DEC1 (ADAMDEC1)

KTE60918-48T 48T
EUR 332
  • The ADAM family is composed of zinc-binding proteins that can function as adhesion proteins and/or endopeptidases.The prototypic ADAM protein has a prodomain, a metalloprotease domain, a disintegrin domain, a cysteine-rich region, a transmembrane dom
  • Show more
Description: Quantitative sandwich ELISA for measuring Human ADAM DEC1 (ADAMDEC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human ADAM DEC1 (ADAMDEC1)

KTE60918-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The ADAM family is composed of zinc-binding proteins that can function as adhesion proteins and/or endopeptidases.The prototypic ADAM protein has a prodomain, a metalloprotease domain, a disintegrin domain, a cysteine-rich region, a transmembrane dom
  • Show more
Description: Quantitative sandwich ELISA for measuring Human ADAM DEC1 (ADAMDEC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human ADAM DEC1 (ADAMDEC1)

KTE60918-96T 96T
EUR 539
  • The ADAM family is composed of zinc-binding proteins that can function as adhesion proteins and/or endopeptidases.The prototypic ADAM protein has a prodomain, a metalloprotease domain, a disintegrin domain, a cysteine-rich region, a transmembrane dom
  • Show more
Description: Quantitative sandwich ELISA for measuring Human ADAM DEC1 (ADAMDEC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Adamdec1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6523402 1.0 ug DNA
EUR 154

Adamdec1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6523403 1.0 ug DNA
EUR 154

Adamdec1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6523404 1.0 ug DNA
EUR 154

Adamdec1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3550002 1.0 ug DNA
EUR 154

Adamdec1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3550003 1.0 ug DNA
EUR 154

Adamdec1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3550004 1.0 ug DNA
EUR 154

ADAMDEC1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0043502 1.0 ug DNA
EUR 154

ADAMDEC1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0043503 1.0 ug DNA
EUR 154

ADAMDEC1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0043504 1.0 ug DNA
EUR 154

ELISA kit for Mouse ADAM DEC1 (ADAMDEC1)

KTE70553-48T 48T
EUR 332
  • The ADAM family is composed of zinc-binding proteins that can function as adhesion proteins and/or endopeptidases.The prototypic ADAM protein has a prodomain, a metalloprotease domain, a disintegrin domain, a cysteine-rich region, a transmembrane dom
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse ADAM DEC1 (ADAMDEC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse ADAM DEC1 (ADAMDEC1)

KTE70553-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The ADAM family is composed of zinc-binding proteins that can function as adhesion proteins and/or endopeptidases.The prototypic ADAM protein has a prodomain, a metalloprotease domain, a disintegrin domain, a cysteine-rich region, a transmembrane dom
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse ADAM DEC1 (ADAMDEC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ADAMDEC1 Rabbit Polyclonal Antibody